View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_30 (Length: 263)
Name: NF19922_high_30
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 3305260 - 3305025
Alignment:
| Q |
16 |
aagaaaggaactaacaaatggacatagctctcttctctacatcatctctcttcgccgaagaagatgatgacgatgacattcataccaagggtactannnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305260 |
aagaaaggaactaacaaatggacatagctctcttctccacatcatctctcttcgccgaagaagatgatgacgatgacattcataccaagggtactactct |
3305161 |
T |
 |
| Q |
116 |
nnnnnnnnnn--------gcttgtttcttctttgattcctatgttgacaaattatgtttctgaatgcagatgaggaaaacgctgagactcatgaaaccta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3305160 |
ctctctctctctctctctgcttgtttcttctttgattcctatgttgacaaattatgtttctgaatgcagatgaggaaaacgctgagactcatgaaactta |
3305061 |
T |
 |
| Q |
208 |
tgttgagaggaagcatcagttccctggaatggtaaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305060 |
tgttgagaggaagcatcagttccctggaatggtaaa |
3305025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University