View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_42 (Length: 245)
Name: NF19922_high_42
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 45767770 - 45768002
Alignment:
| Q |
16 |
aagtataacttagtcactttgaagaaaaactctttagggtaaccttatccgttggtatgaag---gggctagatattaattccatgtgagtcacaattcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45767770 |
aagtataacttagtcactttgaagaaaaactctttagggtaaccttatccgttggtatgaagaaggggctagatattaattccatgtgagtcacaattca |
45767869 |
T |
 |
| Q |
113 |
aaccatgcacattattactaagcaaaatagtcaaaccatttcatgatttacaaatcatcatacttgtaacatcaagtcaacaaagtaacttttgatcgtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45767870 |
aaccatgcacattattactaagcaaaatagtcaaaccaattcatgatttacaaatcatcatacttgtaacatcaagtcaacaaagtaacttttgatcgtg |
45767969 |
T |
 |
| Q |
213 |
tgaaccatatagaatagaatacactataaaagt |
245 |
Q |
| |
|
||||| ||| | |||||||||||||| |||||| |
|
|
| T |
45767970 |
tgaacaatagataatagaatacactacaaaagt |
45768002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University