View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_49 (Length: 226)
Name: NF19922_high_49
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 36700742 - 36700546
Alignment:
| Q |
17 |
atgaagactcgttgttgtcacctttatgattagaagaagggttatggtccatgaattctctaaaggtagatgaagaagtttcatcagaatttgtagcagc |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36700742 |
atgaagactcgttgttgtcaactttatgattagaag---ggttatggtccatgaattctctaaaggtagatgaagaagtttcaccagaatttgtagcagc |
36700646 |
T |
|
| Q |
117 |
agttgcactaccaccacaaccttcaccttgttgtttgaaacttgaacgaaaacgaagcaaccttgaatttggttggttttgttggagttgttgatgatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
36700645 |
agttgcactaccaccacaaccttcaccttgttgtttgaaacttgaacgaaaacgaagcaaccttgaatttggttggttttgttggagttgctgataatga |
36700546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University