View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_51 (Length: 215)
Name: NF19922_high_51
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 43851515 - 43851695
Alignment:
| Q |
17 |
attaaactacacacatacttgtcttaataaccaccatgggaactgagtctccnnnnnnnnnnnnnccaattgcttcttcagaggctgaaaaggtctcttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43851515 |
attaaactacacacatacttgtcttaataaccaccatgggaactgagtctccaaaaaatgaaaaaccaattgcttcttcagaggctgaaaaggtctcttt |
43851614 |
T |
|
| Q |
117 |
ctcagcacaagaaccagttgagaacacttgttattatgtcttgtatttatttgtatgaaaaataaataaaaatctagttct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43851615 |
ctcagcacaagaaccagttgagaacacttgttattatgtcttgtatttatttgtatgaaaaataaataaaaatctagttct |
43851695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University