View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_24 (Length: 329)
Name: NF19922_low_24
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 314
Target Start/End: Original strand, 31836067 - 31836370
Alignment:
| Q |
11 |
aaagaatgatatatatgaggtatcacatttttcaagttttgtcttatgcaaaggatgatccatatgagaaagagctacgtgtgtacaattaaccaatatg |
110 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836067 |
aaaggatgatacatatgaggtatcacatttttcaagttttgtcttatgcaaaggatgatacatatgagaaagagctacgtgtgtacaattaaccaatatg |
31836166 |
T |
 |
| Q |
111 |
tcacaaa-ttggttcttctcatgtcatatgtaaatcaataatcatagaacttcaaattgaatgtcatataatctgaagaaatatttattagcgagaaata |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836167 |
tcacaaaattggttcttctcatgtcatatgtaa-tcaataatcataaaacctcacattgaatgtcatataatctgaagaaatatttattagcgagaaata |
31836265 |
T |
 |
| Q |
210 |
tctctcaccttagaaatcaattttagcgcttgagtctaactcgaccatattaaagtttattttagatcggttgaaccatctattattgaagtactctgat |
309 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |||| ||||||| |||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
31836266 |
tctctcaccttagaaatcaactttaacgcttgagtctaattcgatcatattagagtttattttagatcggttggaccatccattattgaagtactctgat |
31836365 |
T |
 |
| Q |
310 |
catgt |
314 |
Q |
| |
|
||||| |
|
|
| T |
31836366 |
catgt |
31836370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 34 - 78
Target Start/End: Original strand, 31836041 - 31836085
Alignment:
| Q |
34 |
cacatttttcaagttttgtcttatgcaaaggatgatccatatgag |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
31836041 |
cacatttttcaagttttgtctcatgcaaaggatgatacatatgag |
31836085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University