View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_25 (Length: 324)
Name: NF19922_low_25
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 47705082 - 47705264
Alignment:
| Q |
1 |
ttatgagaggattagaactattgtagctttatccttttaaattattttattc-acacactattgctacgtgctaaaaaggtgcgtaatatttttatgtca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705082 |
ttatgagaggattagaactattgtagctttatccttttaaattattttattcaacacactattgctacgtgctaaaaaggtgcgtaatatttttatgtca |
47705181 |
T |
 |
| Q |
100 |
tcctatc-aatatc-------aatcgataattaaaaacattgagtgctctaattaattatgtcatggaataatcatcacacattccc |
178 |
Q |
| |
|
||||| | |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47705182 |
tcctaccaaatatcaatcgataatcgataattaaaaacattgagtgctc----taattatgtcatggaataatcatcacacattccc |
47705264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 204 - 306
Target Start/End: Original strand, 47706518 - 47706620
Alignment:
| Q |
204 |
gtgaaatggttataaagaaatatgatttctgaaattattataattcctggacacatggctaggcaaccttatatccctgactgttaatgttattgcttgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706518 |
gtgaaatggttataaagaaatatgatttctgaaattataataattcctggacacatggctaggcaaccttatatccctgactgttaatgttattgcttgc |
47706617 |
T |
 |
| Q |
304 |
agt |
306 |
Q |
| |
|
||| |
|
|
| T |
47706618 |
agt |
47706620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University