View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_35 (Length: 255)
Name: NF19922_low_35
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 50219885 - 50220085
Alignment:
| Q |
1 |
ttttgaaatacgagatgaaatctgctagacataatatgcatattgtgaaacagaagtattctgctaatgcatatcgtctctttcccctaacnnnnnnnta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
50219885 |
ttttgaaatacgagatgaaatctgctagacataatatgcatattgtgaaacagaagtattctgcaaatgcatatcgtctctttcccctaacaaaaaaata |
50219984 |
T |
 |
| Q |
101 |
catatcatctcatttgttttgtttgcagttttcaccacgctcattgttcttgtaagtaatggagtaactaacaaagctaaactaaaagtaaaaacatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50219985 |
catatcatctcatttgttttgtttgcagttttcaccacgctcattgttcttgtaagtaatggagtaactaacaaagctaaactaaaagtaaaaacatatt |
50220084 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
50220085 |
t |
50220085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University