View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19922_low_35 (Length: 255)

Name: NF19922_low_35
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19922_low_35
NF19922_low_35
[»] chr3 (1 HSPs)
chr3 (1-201)||(50219885-50220085)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 50219885 - 50220085
Alignment:
1 ttttgaaatacgagatgaaatctgctagacataatatgcatattgtgaaacagaagtattctgctaatgcatatcgtctctttcccctaacnnnnnnnta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       ||    
50219885 ttttgaaatacgagatgaaatctgctagacataatatgcatattgtgaaacagaagtattctgcaaatgcatatcgtctctttcccctaacaaaaaaata 50219984  T
101 catatcatctcatttgttttgtttgcagttttcaccacgctcattgttcttgtaagtaatggagtaactaacaaagctaaactaaaagtaaaaacatatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50219985 catatcatctcatttgttttgtttgcagttttcaccacgctcattgttcttgtaagtaatggagtaactaacaaagctaaactaaaagtaaaaacatatt 50220084  T
201 t 201  Q
    |    
50220085 t 50220085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University