View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19922_low_36 (Length: 251)

Name: NF19922_low_36
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19922_low_36
NF19922_low_36
[»] chr1 (2 HSPs)
chr1 (159-251)||(4091424-4091516)
chr1 (12-67)||(4091336-4091391)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 159 - 251
Target Start/End: Original strand, 4091424 - 4091516
Alignment:
159 gcattcatttatatgtaatacaagccatttacaattcaaactaatcttaattaacacataaaatttggtcatgtaaattatatgtttttccta 251  Q
    |||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4091424 gcatgcattcatatgtaatacaaaccatttacaattcaaactaatcttaattaacacataaaatttggtcatgtaaattatatgtttttccta 4091516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 4091336 - 4091391
Alignment:
12 tatacttatcttgcagtctattttatatggtgtgacaaaaatatattattgaggat 67  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
4091336 tatacttatcttgcagtctattttatatggtgtgacaacaatatattattgaggat 4091391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University