View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_41 (Length: 249)
Name: NF19922_low_41
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 47 - 233
Target Start/End: Original strand, 47728349 - 47728535
Alignment:
| Q |
47 |
acactgaatattacttaagaagttgtcaagccatcttttcaactggaccattacgcattttagcacaatactcaaataggcttccatcaaaacaacgtct |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47728349 |
acactgaatattacttaagaagttgtcaagccatcttttcaactggaccattacgcattttagcacagtactcaaataggcttccatcaaaacaacgtct |
47728448 |
T |
|
| Q |
147 |
cacagcttcttttgacagaaaaccttgttcatcttttgctagaatatacaaagcaccccattcaagtttgctggcagccctgcaaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47728449 |
cacagcttcttttgacagaaaaccttgttcatcttttgctagaatatacaaagccccccattcaagtttgctggcagccctgcaaat |
47728535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 47728267 - 47728307
Alignment:
| Q |
8 |
tagcaaaggtagaagaaaagcattgaagtgcaataatgtac |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47728267 |
tagcaaaggtagaagaaaagcattgaagtgcaataatgtac |
47728307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University