View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_43 (Length: 248)
Name: NF19922_low_43
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 11 - 209
Target Start/End: Complemental strand, 28980335 - 28980136
Alignment:
| Q |
11 |
caaaggttgaatttatgaatctttgtaa-gcttcgtagaaagttcttctaactttaccatannnnnnnattcaattattttgttgaaaactcataccgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28980335 |
caaaggttgaatttatgaatctttgtaaagcttcgtagaaagttcttctaactttaccatatttttttattcaattattttgttgaaaactcataccgaa |
28980236 |
T |
|
| Q |
110 |
atcggtccaattagactttttaggaaaaaattatgactctggtcttcaatagataatattggatggcaggtttattaaacaatttatacttgtatattaa |
209 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28980235 |
atcggtccagttagactttttagaaaaaaattatgactctggtcttcaatagataatattggatgacaggtttattaaacaatttatacttgtatattaa |
28980136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University