View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_46 (Length: 239)
Name: NF19922_low_46
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 33636008 - 33636065
Alignment:
| Q |
165 |
cagcaaaaatgtgtaatgtttaaagtttgatatttataaaatactagatacatgagaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636008 |
cagcaaaaatgtgtaatgtttaaagtttgatatttataaaatactagatacatgagaa |
33636065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 148
Target Start/End: Original strand, 33635961 - 33635990
Alignment:
| Q |
119 |
tcattcctcctacttttaattgtgtaatga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33635961 |
tcattcctcctacttttaattgtgtaatga |
33635990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University