View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_48 (Length: 235)
Name: NF19922_low_48
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 41081903 - 41081686
Alignment:
| Q |
1 |
tggtgttcaatctcacttatgtggttgctcttatctcaatgtgatgatctccggtattttaggacttcctcatgagtcatgaccttacacaccacatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41081903 |
tggtgttcaatctcacttatgtggttgctcttatctcaatgtgatgatctccggtattttaggacttcctcatgagtcatgaccttacacaccacatgtt |
41081804 |
T |
|
| Q |
101 |
tcagataattaactatc-aatgacttgtgacatagcatataattggtactaatcattgattttcttgttcatagcttggattactttaattattaatttt |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41081803 |
tcagataattaactatcaaatgacttgtgtcatagcatataattggtacta---aatcattttcttgttcatagcttggattactttaattattaatttt |
41081707 |
T |
|
| Q |
200 |
aatgaagatgtaaattgctaaagt |
223 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
41081706 |
aat---gatgtaaattgctaaagt |
41081686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 24076665 - 24076706
Alignment:
| Q |
20 |
tgtggttgctcttatctcaatgtgatgatctccggtatttta |
61 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
24076665 |
tgtggttgatcttaacacaatgtgatgatctccggtatttta |
24076706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 38804040 - 38803999
Alignment:
| Q |
4 |
tgttcaatctcacttatgtggttgctcttatctcaatgtgat |
45 |
Q |
| |
|
||||||| ||||||| |||||||||||||| ||||||||||| |
|
|
| T |
38804040 |
tgttcaacctcacttgtgtggttgctcttaactcaatgtgat |
38803999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University