View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19922_low_51 (Length: 226)

Name: NF19922_low_51
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19922_low_51
NF19922_low_51
[»] chr7 (1 HSPs)
chr7 (17-216)||(36700546-36700742)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 36700742 - 36700546
Alignment:
17 atgaagactcgttgttgtcacctttatgattagaagaagggttatggtccatgaattctctaaaggtagatgaagaagtttcatcagaatttgtagcagc 116  Q
    |||||||||||||||||||| |||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
36700742 atgaagactcgttgttgtcaactttatgattagaag---ggttatggtccatgaattctctaaaggtagatgaagaagtttcaccagaatttgtagcagc 36700646  T
117 agttgcactaccaccacaaccttcaccttgttgtttgaaacttgaacgaaaacgaagcaaccttgaatttggttggttttgttggagttgttgatgatga 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||    
36700645 agttgcactaccaccacaaccttcaccttgttgtttgaaacttgaacgaaaacgaagcaaccttgaatttggttggttttgttggagttgctgataatga 36700546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University