View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_low_9 (Length: 402)
Name: NF19922_low_9
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 50 - 217
Target Start/End: Complemental strand, 14132687 - 14132515
Alignment:
| Q |
50 |
tcttaactaagtgactgccaaggcccacatatagta-----acaagtggatccatccctatctagaacgctagattgttttaactctaaaataagagaaa |
144 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||| |||||||||||| ||||| |||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
14132687 |
tcttaattaagtgacggccaaggcccacatatagtatagtaacaagtggatccgtccctgtctagagcgctagattgttttggctctgaaataagagaaa |
14132588 |
T |
 |
| Q |
145 |
gtaatgattcaaaaatcgaaagcgaatgaaaaagtagtttatatgatatatgagtgtcaagaatttatttatg |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
14132587 |
gtaatgattcaaaaattgaaagcgaatgaaaaagtagtttatacgatatacgagtgtcaagaatttatgtatg |
14132515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 299 - 384
Target Start/End: Complemental strand, 14132433 - 14132347
Alignment:
| Q |
299 |
tgttaccttgcaattgagatgcaacaagaaagggttacta--acttgagagttgagatccttgacacaccacagaaagcagtactagc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14132433 |
tgttaccttgcaattgagatgcaacaagaaatggt-actttgacttgagagttgagatccttgacacaccacagaaagcagtactagc |
14132347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University