View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19923_high_15 (Length: 251)
Name: NF19923_high_15
Description: NF19923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19923_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 30768930 - 30769153
Alignment:
| Q |
12 |
atactgagaggtaaccttgaaagcttatttcgattaaatacatcactgatttgtgtattannnnnnnattcttatgtagtatatcctcgatacgaagatg |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30768930 |
atactgagaggtaacattgaaagcttatttcgattaaatacatcactgatttgtgtattatttttttattcttatgtagtatatcctcgatacgaagatg |
30769029 |
T |
 |
| Q |
112 |
gtatttcctgctcctaagaagccccaggaacgtgttgatcttattgcatatctgaaataggatgcttgaaaatgattgaagttatgtatcatatgtagta |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769030 |
gtatttcctgctcttaagaagccccaggaacgtgttgatcttattgcatatctgaaataggatgcttgaaaatgattgaagttatgtatcatatgtagta |
30769129 |
T |
 |
| Q |
212 |
tacttttggagttctggatattta |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30769130 |
tacttttggagttctggatattta |
30769153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 168
Target Start/End: Original strand, 30772883 - 30772945
Alignment:
| Q |
106 |
aagatggtatttcctgctcctaagaagccccaggaacgtgttgatcttattgcatatctgaaa |
168 |
Q |
| |
|
|||||||| ||||||| || ||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
30772883 |
aagatggtttttcctggtcttaagaagcctcaagaacgtgctgatcttattgcatatctgaaa |
30772945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 167
Target Start/End: Original strand, 1793114 - 1793175
Alignment:
| Q |
106 |
aagatggtatttcctgctcctaagaagccccaggaacgtgttgatcttattgcatatctgaa |
167 |
Q |
| |
|
|||||||||||||| | || ||||| ||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
1793114 |
aagatggtatttcccggtctaaagaaaccccaagaacgcgctgatcttattgcatatctgaa |
1793175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University