View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19923_high_9 (Length: 389)
Name: NF19923_high_9
Description: NF19923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19923_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 20 - 379
Target Start/End: Complemental strand, 2302792 - 2302433
Alignment:
| Q |
20 |
gttcttggttttggaatatatggaaaagggaagcttgtattgtgttctacacaatgatgttgaagcagtggaattggattggtgtaaaagggttgagatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302792 |
gttcttggttttggaatatatggaaaagggaagcttgtattgtgttctacgcaatgatgttgaagcagtggaattggattggtgtaaaagggttgagatt |
2302693 |
T |
 |
| Q |
120 |
gtgaaaggaattgcaaatagcttatcttaccttcattatgattgcaagccagcaattattcacagagatgttactaccaaaaatgttctcttgaactcag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2302692 |
gtgaaaggaattgcaaatagcttatcttaccttcattatgattgcgagccagcaattattcacagagatgtgactaccaaaaatgttctcttgaactcag |
2302593 |
T |
 |
| Q |
220 |
aaatggaagcttgtctttctgattttggcatagctagacttcgaaattctagttcgtcgaaccggacagtacttgcaggcacatatggatatattgcacc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2302592 |
aaatggaagcttgtctttctgattttggcatagctagacttcgaaattctagttcgtcgaaccggacagtccttgcaggcacatatggatatattgcacc |
2302493 |
T |
 |
| Q |
320 |
aggtgatcttttttatatgttaattgttggaaattccttcttaaatgtagtctgcctttg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302492 |
aggtgatcttttttatatgttaattgttggaaattccttcttaaatgtagtctgcctttg |
2302433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University