View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19923_low_11 (Length: 339)
Name: NF19923_low_11
Description: NF19923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19923_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 315
Target Start/End: Original strand, 46896869 - 46897183
Alignment:
| Q |
1 |
cggatcccccacctccaactagggcactatccaagttcgtcatttaaaagggtgtggtaaatttctgacacctgccacgtgcgtgtggggctttggggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46896869 |
cggatcccccacctccaactagggcactatccaagttcgtcatttaaaagggtgtggtaaatttctgacacctgccacgtgcgtgtggggctttggggtt |
46896968 |
T |
 |
| Q |
101 |
cttgaaaagaaagaaagtaattttagggcaaagttagcactctcacaattccactcaatgtattatttaacctaaaatattttgcttttctcagcaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46896969 |
cttgaaaagaaagaaagtaattttagggcaaagttagcactctcacaattccactcaatgtattatttaacctaaaatattttgcttttctcagcaaaat |
46897068 |
T |
 |
| Q |
201 |
cattcatgcaccagagaatttattctcgccannnnnnnncaatttctttgtgcatatgggtggagcctcttacatctcatatcccaaattctcattatat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46897069 |
cattcatgcaccagagaatttattctcgccattttttttcaatttctttgtgcatatgggtggagcctcttacatctcatatcccaaattctcattatat |
46897168 |
T |
 |
| Q |
301 |
ttcacaagaacaaat |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46897169 |
ttcacaagaacaaat |
46897183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University