View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19923_low_15 (Length: 276)
Name: NF19923_low_15
Description: NF19923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19923_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 89 - 196
Target Start/End: Original strand, 5441994 - 5442103
Alignment:
| Q |
89 |
gtaaaatactcaagcagccgtgcggcgttggttatcatat--ttattacgaaataatattagtcattaaattgcacaagatatgnnnnnnnattagaaat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5441994 |
gtaaaatactcaagcagccgtgcggcgttggttatcatatatttattacgaaataatattagtcattaaattgcacaagatatgtttttttattagaaat |
5442093 |
T |
 |
| Q |
187 |
ttcacaatat |
196 |
Q |
| |
|
|||||||||| |
|
|
| T |
5442094 |
ttcacaatat |
5442103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 5442094 - 5442138
Alignment:
| Q |
205 |
ttcacaatatatgctgattcacatctgctctcacgaaaacatgta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442094 |
ttcacaatatatgctgattcacatctgctctcacgaaaacatgta |
5442138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 68
Target Start/End: Original strand, 5441943 - 5441996
Alignment:
| Q |
10 |
ataattctgcttctgcagcaatccaggtcttttactttagacactaataaatgtgtgta |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
5441943 |
ataattctgcttctgcagca-----ggtcttttactttagagactaataaatgtgtgta |
5441996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University