View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19924_low_25 (Length: 355)
Name: NF19924_low_25
Description: NF19924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19924_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 38135926 - 38135585
Alignment:
| Q |
1 |
ttgtggcagatcaaggtgtgccaagctttatttattatttatgactttacataaatagtcagagtttatcatttatccgttctcggtgtattgcgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
38135926 |
ttgtggcagatcaaggtgtgccaagctttatttattatttatgactttacataaatagtcagagtttatcgtttatccgttctcggtgtattgcgtatgg |
38135827 |
T |
 |
| Q |
101 |
gaaattgctagccgcagaatttgcatgtgcacacatggttccaactttcacaaactagaaaccacaaaaattcgatattggtttttgtttttaaaagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38135826 |
gaaattgctagccgcagaatttgcatgtgcacacatggttccaactttcacaaactagaaaccacaaaaattcaatattggtttttgtttttaaaagttt |
38135727 |
T |
 |
| Q |
201 |
caaaacttaaaactaacaagtaaactgaacaaggtctctgcttttgttgtcatattttattcttttgaaggaaatggtaagcaaaaatcttatgcagtta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
38135726 |
caaaacttaaaactaacaagtaaactgaacaaggcctctgcttttgttgtcatattttattcttttgaaggaaatggtaagc-aaaatcttttgcagtta |
38135628 |
T |
 |
| Q |
301 |
gtcttctttttatctacactgcaaaggcaaacatttaatattt |
343 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38135627 |
gacttcattttatctacactgcaaaggcaaacattttatattt |
38135585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University