View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19924_low_30 (Length: 310)
Name: NF19924_low_30
Description: NF19924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19924_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 36322300 - 36322599
Alignment:
| Q |
1 |
aagtttctttggtcatactaggtacttta----tttatttattttaatggctcatactaggtaataattaagaccaagaatttcatggataatttttcct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36322300 |
aagtttctttggtcatactaggtactttatttatttatttattttaatggctcatactaggtaataattaagaccaagaatttcatggataatttttcct |
36322399 |
T |
|
| Q |
97 |
ttccttataagtagtaagtagtataattacatgaaaaataaccaatatggattattgggattattaattgcaattatttttgctaataattgtggaattt |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36322400 |
ttccttgtaagtagtaagtagtataattacatgaaaaataaccaatatggattattgggattattaattgcaattatttttgctaataattgtggaattt |
36322499 |
T |
|
| Q |
197 |
gggtacgtgtgaggtgcaggggcgtttgcgcttgagaacatggcaacttttgcactagcagtgaactttgtgtcatacttcgttggtttcatgcattatg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36322500 |
gggtacgtgtgaggtgcaggggcgtttgcgcttgagaacatggcaacttttgcactagcagtgaactttgtgtcatacttcgttggtttcatgcattatg |
36322599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 209 - 296
Target Start/End: Original strand, 36329310 - 36329397
Alignment:
| Q |
209 |
ggtgcaggggcgtttgcgcttgagaacatggcaacttttgcactagcagtgaactttgtgtcatacttcgttggtttcatgcattatg |
296 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| | |||||||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
36329310 |
ggtgcaggggcgtttgcttttgagagcatggcaactctagcactagcagtgaactttgtgtcatacttcattgggattatgcattatg |
36329397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University