View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19924_low_40 (Length: 250)
Name: NF19924_low_40
Description: NF19924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19924_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 9 - 129
Target Start/End: Original strand, 48144838 - 48144958
Alignment:
| Q |
9 |
gaagaatattcaaagggatgtttgattgtattattcgtactgttagggaagaaggtgttatctctttatggcgtggtaatgggagtagtgttcttcgtta |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48144838 |
gaagaaaattcaaagggatgtttgattgtattattcgtaccgttagggaagaaggtgttatctctttatggcgtggtaatgggagtagtgttcttcgtta |
48144937 |
T |
 |
| Q |
109 |
ttatccttctgttgcactcaa |
129 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48144938 |
ttatccttctgttgcactcaa |
48144958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 179 - 250
Target Start/End: Original strand, 48145008 - 48145079
Alignment:
| Q |
179 |
attgctttgtattgaaatggataatccgtgatattgcaagttattaatatattatgcaaacatttggaactt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48145008 |
attgctttgtattgaaatggataatccgtgatattgcaagttattaatatattatgcaaacatttggaactt |
48145079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University