View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19924_low_45 (Length: 210)

Name: NF19924_low_45
Description: NF19924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19924_low_45
NF19924_low_45
[»] chr4 (2 HSPs)
chr4 (18-89)||(45100670-45100741)
chr4 (142-175)||(45100584-45100617)
[»] chr1 (3 HSPs)
chr1 (18-89)||(12228850-12228921)
chr1 (18-89)||(35167013-35167083)
chr1 (142-175)||(12228764-12228797)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 45100741 - 45100670
Alignment:
Q  18 cttacatattcgaatattgcaataatcaaattgaattgaatgaaatttaaactactttgagtctaaatgctc 89  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45100741 cttacatattcgaatattgcaataatcaaattgaattgaatgaaatttaaactactttgagtctaaatgctc 45100670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 175
Target Start/End: Complemental strand, 45100617 - 45100584
Alignment:
Q  142 tactaattgtcgtccttcccatcttttaagcgtc 175  Q
    ||||||||||||||||||||||||||||||||||    
T  45100617 tactaattgtcgtccttcccatcttttaagcgtc 45100584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 12228921 - 12228850
Alignment:
Q  18 cttacatattcgaatattgcaataatcaaattgaattgaatgaaatttaaactactttgagtctaaatgctc 89  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||    
T  12228921 cttacatattcgaatattgcaataatcaaattaaattgaataaaatttaaactactttgagtctaaatgctc 12228850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 35167013 - 35167083
Alignment:
Q  18 cttacatattcgaatattgcaataatcaaattgaattgaatgaaatttaaactactttgagtctaaatgctc 89  Q
    |||||||||| ||||||||||||||||||||| |||||||| |||||||||||| |||||||| ||||||||    
T  35167013 cttacatatttgaatattgcaataatcaaattaaattgaataaaatttaaacta-tttgagtcgaaatgctc 35167083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 175
Target Start/End: Complemental strand, 12228797 - 12228764
Alignment:
Q  142 tactaattgtcgtccttcccatcttttaagcgtc 175  Q
    ||||||||||||||||||||||||||||||||||    
T  12228797 tactaattgtcgtccttcccatcttttaagcgtc 12228764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University