View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19925_low_2 (Length: 264)
Name: NF19925_low_2
Description: NF19925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19925_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 1784449 - 1784694
Alignment:
| Q |
1 |
acaagtgcttgtatttgtcacctttggagaatctttgccttagaatgataaatcttgtctcttgtatttttataataaccattgctttttaggatatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1784449 |
acaagtgcttgtatttgtcacctttggagaatctttgccttagaatgataaatcttgtctcttgtatttttataataaccattgctttttaggatatttt |
1784548 |
T |
|
| Q |
101 |
aatttggtttctctttaattataaatgcatgacaatgannnnnnnngttaaaatagaagaaattgtcttatcaagtgagaataacattataattggacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1784549 |
aatttggtttctctttaattataaatgcatgacaatgattttttttgttaaaatagaagaaattgtcttatcaagtgagaataacattataattggacta |
1784648 |
T |
|
| Q |
201 |
tacagtaacttgcattggccggcaacaagactaattgtacacaaga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1784649 |
tacagtaacttgcattggccggcaacaagactaattgtacacaaga |
1784694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 75 - 116
Target Start/End: Original strand, 1789571 - 1789612
Alignment:
| Q |
75 |
ataaccattgctttttaggatattttaatttggtttctcttt |
116 |
Q |
| |
|
||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
1789571 |
ataaccattcctttttagaatattttagtttggtttctcttt |
1789612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University