View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19926_low_5 (Length: 251)

Name: NF19926_low_5
Description: NF19926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19926_low_5
NF19926_low_5
[»] chr2 (7 HSPs)
chr2 (55-236)||(8277183-8277364)
chr2 (55-238)||(11573807-11573997)
chr2 (55-234)||(31133288-31133467)
chr2 (63-194)||(20927513-20927644)
chr2 (63-200)||(35000438-35000575)
chr2 (76-196)||(22787796-22787916)
chr2 (86-194)||(9829375-9829483)
[»] chr6 (4 HSPs)
chr6 (55-236)||(32275543-32275724)
chr6 (55-236)||(31522345-31522526)
chr6 (79-194)||(13543678-13543792)
chr6 (55-166)||(4321530-4321633)
[»] chr4 (17 HSPs)
chr4 (55-236)||(23283337-23283518)
chr4 (55-236)||(36499082-36499263)
chr4 (67-236)||(55523901-55524070)
chr4 (55-212)||(24972590-24972746)
chr4 (55-236)||(45246753-45246934)
chr4 (87-236)||(12586361-12586510)
chr4 (66-194)||(22182152-22182280)
chr4 (55-194)||(33990762-33990901)
chr4 (55-194)||(50008797-50008936)
chr4 (86-194)||(43210023-43210129)
chr4 (86-194)||(1938580-1938688)
chr4 (86-194)||(41418911-41419019)
chr4 (95-194)||(156886-156985)
chr4 (55-194)||(50336192-50336331)
chr4 (86-194)||(12656515-12656630)
chr4 (86-181)||(6599373-6599469)
chr4 (168-206)||(29348901-29348938)
[»] chr3 (13 HSPs)
chr3 (55-236)||(7666689-7666870)
chr3 (55-236)||(35995262-35995443)
chr3 (55-238)||(35063090-35063272)
chr3 (55-228)||(19866917-19867090)
chr3 (55-212)||(34086559-34086718)
chr3 (55-175)||(39649705-39649825)
chr3 (86-194)||(14443751-14443859)
chr3 (86-194)||(54335654-54335762)
chr3 (55-194)||(30933795-30933934)
chr3 (86-194)||(11916930-11917038)
chr3 (55-194)||(20518049-20518188)
chr3 (87-194)||(30528497-30528604)
chr3 (55-194)||(53767224-53767363)
[»] scaffold1063 (1 HSPs)
scaffold1063 (55-235)||(1601-1782)
[»] chr5 (12 HSPs)
chr5 (55-236)||(763105-763285)
chr5 (65-236)||(30491525-30491697)
chr5 (55-211)||(34017399-34017555)
chr5 (57-212)||(38739536-38739690)
chr5 (55-212)||(5504917-5505068)
chr5 (99-235)||(33143948-33144085)
chr5 (86-194)||(20887698-20887806)
chr5 (55-194)||(32910585-32910724)
chr5 (63-153)||(15235047-15235137)
chr5 (109-195)||(16109318-16109403)
chr5 (86-194)||(29195858-29195966)
chr5 (116-194)||(8736470-8736550)
[»] chr1 (10 HSPs)
chr1 (55-236)||(33402866-33403047)
chr1 (55-236)||(35577246-35577426)
chr1 (55-236)||(48025714-48025894)
chr1 (55-212)||(25817598-25817755)
chr1 (55-195)||(3368236-3368376)
chr1 (86-194)||(16315158-16315266)
chr1 (86-194)||(12063560-12063668)
chr1 (55-194)||(23941635-23941774)
chr1 (90-194)||(30704342-30704446)
chr1 (87-130)||(18426397-18426440)
[»] scaffold0037 (1 HSPs)
scaffold0037 (55-236)||(38109-38289)
[»] chr8 (10 HSPs)
chr8 (55-236)||(34276368-34276548)
chr8 (86-194)||(14189780-14189890)
chr8 (86-194)||(24626064-24626172)
chr8 (159-236)||(33228293-33228370)
chr8 (55-195)||(2807157-2807296)
chr8 (63-165)||(32075054-32075156)
chr8 (63-146)||(20532099-20532182)
chr8 (79-194)||(13868202-13868319)
chr8 (147-194)||(20534374-20534421)
chr8 (123-194)||(41601120-41601191)
[»] chr7 (12 HSPs)
chr7 (55-215)||(2369658-2369818)
chr7 (55-226)||(4452382-4452553)
chr7 (116-226)||(4452765-4452873)
chr7 (55-194)||(44222009-44222148)
chr7 (55-194)||(23941343-23941482)
chr7 (86-194)||(4278602-4278711)
chr7 (155-236)||(10526856-10526937)
chr7 (55-194)||(11356339-11356478)
chr7 (124-194)||(13070509-13070579)
chr7 (86-144)||(12868664-12868722)
chr7 (87-194)||(31730907-31731015)
chr7 (63-127)||(23562298-23562362)
[»] scaffold0599 (1 HSPs)
scaffold0599 (86-194)||(8681-8789)
[»] scaffold1050 (1 HSPs)
scaffold1050 (92-194)||(2061-2163)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 8277183 - 8277364
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||    
8277183 gttttgacgatacattacctgttctttgatacttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttggaatgaagatttttacccaaaat 8277282  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||  || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
8277283 tttgcatttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctactgggttttgaacaaaaata 8277364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 55 - 238
Target Start/End: Complemental strand, 11573997 - 11573807
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||    
11573997 gttttgacggtacattacctgttctttgatgcttgatgagcatagaaacttgtttcctgacgatttgcaatgatttggaatgaagatttttacccaaaat 11573898  T
155 t-------tcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaataat 238  Q
    |       || |||||||| ||||||||||||||||||||||||||||||||||||||||||||| || | || |||||||| ||||||||    
11573897 ttcgcacatcgcacttttggggtttttggaggtggagggaaagaaaaaatggagctttgtggttgtctgctgggttttgaacgaaaataat 11573807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 55 - 234
Target Start/End: Complemental strand, 31133467 - 31133288
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||| | ||||||||| |||  |||||||||||||| ||||||||||||||||||  |||||||     
31133467 gttttgacggtacattacctgttctttgatgcttgatgaacatagaaacttgttttataacgatttgcaataatttggaatgaagattttgacccaaaaa 31133368  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaa 234  Q
    ||| |||||||  |||||||||||||||||||| | ||||||||||||||||||||||||||| || |||||||| ||||    
31133367 ttctcactttttgggtttttggaggtggagggataaaaaaaatggagctttgtggttgcctactgggttttgaacgaaaa 31133288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 63 - 194
Target Start/End: Original strand, 20927513 - 20927644
Alignment:
63 gatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacact 162  Q
    |||||||||| || | |||||| ||||||||||||||||||||  ||||| |||||||||||||||||||||||||||||||  || |||||||  ||||    
20927513 gatacattacctgatatttgatgcttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttggaatgaagattttgacctaaaattttgcact 20927612  T
163 tttgaggtttttggaggtggagggaaagaaaa 194  Q
    |||  |||||||| ||||||||||||||||||    
20927613 ttttgggtttttgaaggtggagggaaagaaaa 20927644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 63 - 200
Target Start/End: Complemental strand, 35000575 - 35000438
Alignment:
63 gatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacact 162  Q
    |||||||||| ||||||||||| ||||||||| ||| | ||||  |||||  |||||||||||||||||||| |||||||||  ||||||| ||| ||||    
35000575 gatacattacctgttctttgatgcttgatgagtgtatagacttgcttcctggcgatttgcaatgatttggaacgaagattttgacccaaaagttcgcact 35000476  T
163 tttgaggtttttggaggtggagggaaagaaaaaatgga 200  Q
    |||  ||||||| |||||||| ||||||||||||||||    
35000475 ttttgggtttttagaggtggaaggaaagaaaaaatgga 35000438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 76 - 196
Target Start/End: Original strand, 22787796 - 22787916
Alignment:
76 ttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttg 175  Q
    |||| |||| ||||||||||||||||||||  ||| | ||||||||||||||||| |||||||||||||  ||||||| ||| ||||||   ||||||||    
22787796 ttctatgatgcttgatgagcgtagaaacttacttcatgacgatttgcaatgatttagaatgaagattttgacccaaaaattcgcactttatgggtttttg 22787895  T
176 gaggtggagggaaagaaaaaa 196  Q
    |||||||||||||||||||||    
22787896 gaggtggagggaaagaaaaaa 22787916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 9829375 - 9829483
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  ||||||| ||| |||||||   ||||||| |||||||||    
9829375 cttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaattcgcactttttgagtttttgaaggtggagg 9829474  T
186 gaaagaaaa 194  Q
    |||||||||    
9829475 gaaagaaaa 9829483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 32275543 - 32275724
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| ||||||||||||||||| || |||||| ||||||||||| |||||||||||||||||||| ||||||||    
32275543 gttttgacggtacattacatgttctttgatgcttgatgagcgtagaaatttgtttcctgacgatttgcaaagatttggaatgaagatttttacccaaaat 32275642  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||| ||||||    
32275643 ttcgcacttttggggtttttggaggtggaggaaaagaaaaaatggagctttgtggttgcctgctggattttgaacgaaaata 32275724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 31522345 - 31522526
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||| ||||||||| |||||| |||||||||||||||||||||| ||||||||| ||||||||    
31522345 gttttgacggtacattacctgttctttgatgcttgatgagcatagaaacttgtttcctgacgatttgcaatgatttggaattaagatttttacccaaaat 31522444  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||| | | || |||||||| ||||||    
31522445 ttcgcacttttggggtttttggaggtggagggaaagaaaaaatggagctatgtggttgcttgctgggttttgaacgaaaata 31522526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 79 - 194
Target Start/End: Original strand, 13543678 - 13543792
Alignment:
79 tttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaattt-cacacttttgaggtttttgga 177  Q
    |||||| |||||||||||||||| |||  |||||| ||||||||||||||||||||| ||||||||  || |||| || ||| |||||| ||||||||||    
13543678 tttgatgcttgatgagcgtagaagcttgcttcctaccgatttgcaatgatttggaataaagattttgaccaaaaaattgcac-cttttg-ggtttttgga 13543775  T
178 ggtggagggaaagaaaa 194  Q
    |||||||||||||||||    
13543776 ggtggagggaaagaaaa 13543792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 55 - 166
Target Start/End: Original strand, 4321530 - 4321633
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| | |||||||| |||||||||||  |||||||||||||||||||||  || ||        ||||||||||||||||||||||| ||||||||    
4321530 gttttgatggtacattacctgttctttgatgattgatgagcgtagaaacttttacccaaa--------aatgatttggaatgaagatttttacccaaaat 4321621  T
155 ttcacacttttg 166  Q
    ||  ||||||||    
4321622 tttgcacttttg 4321633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 17)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 55 - 236
Target Start/End: Complemental strand, 23283518 - 23283337
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||| ||||||||    
23283518 gttttgacggtacattacctgttctttgatgcttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttagaatgaagatttttacccaaaat 23283419  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||  |||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||||    
23283418 tttgcacttttggggtttttggaggtggagggaaagaaaaaatggagctttatggttgcatactggattttgaacgaaaata 23283337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 55 - 236
Target Start/End: Complemental strand, 36499263 - 36499082
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| || ||||| ||||||||||| ||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||| ||||||||    
36499263 gttttgacggtaaattacctgttctttgatgcttgatgagcgtagaaatttgtttcctgacgatttgcaatgatttggaatgaagatttttacccaaaat 36499164  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |  | |||||||| ||||||    
36499163 ttcgcacttttggggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctgcttggttttgaacgaaaata 36499082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 67 - 236
Target Start/End: Complemental strand, 55524070 - 55523901
Alignment:
67 cattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttg 166  Q
    |||||| | ||||||||| |||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||| ||||||||||| ||||||||    
55524070 cattacatattctttgatgcttgatgagcgtagaaacttgtttcctgacgatttacaatgatttggaatgaagatttttacccaaaatttcgcacttttg 55523971  T
167 aggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
     |||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||    
55523970 gggtttttgcaggtggagggaaagaaaaaatggagctttgtggttgcctactgggttttgaacgaaaata 55523901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 55 - 212
Target Start/End: Complemental strand, 24972746 - 24972590
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| |||| |||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||    
24972746 gttttgacggtacattacctgttatttgatgcttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttggaatgaagatttttacccaaaat 24972647  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 212  Q
    ||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
24972646 ttcgcacttttggggtttttggaggtggagggaaaga-aaaatggagctttgtggttg 24972590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 45246753 - 45246934
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||||| ||||||| |||| | |||||||||||||||||||||||||||||||| ||||||||    
45246753 gttttgacggtacattacctgttctttgatgcttgatgagcgtggaaacttgtttcttgacgatttgcaatgatttggaatgaagatttttacccaaaat 45246852  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    |||||||||||   |||||||||||||||||||||| |||| | ||||||||||||||||| | ||||||||||| ||||||    
45246853 ttcacacttttagagtttttggaggtggagggaaaggaaaagtcgagctttgtggttgcctgctggattttgaacgaaaata 45246934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 87 - 236
Target Start/End: Complemental strand, 12586510 - 12586361
Alignment:
87 ttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggaggg 186  Q
    ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||  |||||||| |||||||||||||||||||    
12586510 ttgatgagcgtagaaacttatttcctgacgatttgcaatgatttggaatgaagatttttacccaaaattttgcacttttggggtttttggaggtggaggg 12586411  T
187 aaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||||||||||||||| ||| ||||||| | | || |||||||| ||||||    
12586410 aaagaaaaaatggagttttatggttgcatgctgggttttgaacgaaaata 12586361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 66 - 194
Target Start/End: Original strand, 22182152 - 22182280
Alignment:
66 acattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacactttt 165  Q
    ||||||| || | |||||| ||||||||||||||||||||  ||| |||||||||||||||||||||||||||||||||  || ||||  |  |||||||    
22182152 acattacctgatatttgatgcttgatgagcgtagaaacttgcttcttaacgatttgcaatgatttggaatgaagattttgacctaaaaaattgcactttt 22182251  T
166 gaggtttttggaggtggagggaaagaaaa 194  Q
      |||||||||||||||||||||||||||    
22182252 tgggtttttggaggtggagggaaagaaaa 22182280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 33990901 - 33990762
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| |||||| | |||| | ||||||||||||||||||||  ||| | ||||||||||||||||||| |||| ||||||  |||||||     
33990901 gttttgatgatacaatacttgatatttggtgcttgatgagcgtagaaacttgattcatgacgatttgcaatgatttgggatgaggattttgacccaaaaa 33990802  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     || |||||||  |||||||| ||||||| ||||||||||    
33990801 atcgcactttttgggtttttgaaggtggaaggaaagaaaa 33990762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 55 - 194
Target Start/End: Original strand, 50008797 - 50008936
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  |||||||     
50008797 gttttgatgatacaatacctgatatttggtgcttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaa 50008896  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     || |||||||  |||||||| |||| |||||||||||||    
50008897 atcgcacttttttggtttttgaaggtcgagggaaagaaaa 50008936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 43210023 - 43210129
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  |||||||  || |||||||  |||||||| |||||||||    
43210023 cttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaaatcgcactttt--ggtttttgaaggtggagg 43210120  T
186 gaaagaaaa 194  Q
    |||||||||    
43210121 gaaagaaaa 43210129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 1938688 - 1938580
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    |||||||||| |||||||||| || || ||||||||||||||||||| |||| ||||||  |||||||  || |||||||  |||||||| |||||||||    
1938688 cttgatgagcatagaaactttctttctgacgatttgcaatgatttgggatgaggattttgacccaaaaaatcgcactttttgggtttttgaaggtggagg 1938589  T
186 gaaagaaaa 194  Q
    |||||||||    
1938588 gaaagaaaa 1938580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 41419019 - 41418911
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||   ||||||||||||| |||||||||| |||| ||||||  |||||||  || |||||||  |||||||| |||||||||    
41419019 cttgatgagcgtagaaacttgcgtcctaacgatttgtaatgatttgggatgaggattttgacccaaaaaatcgcactttttgggtttttgaaggtggagg 41418920  T
186 gaaagaaaa 194  Q
    |||||||||    
41418919 gaaagaaaa 41418911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 95 - 194
Target Start/End: Original strand, 156886 - 156985
Alignment:
95 cgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    |||||||||||  ||||| ||||||||||||||||||| |||| ||||||  ||||||| ||| |||||||  |||||||| ||||||||||||||||||    
156886 cgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaattcgcactttttgggtttttgaaggtggagggaaagaaaa 156985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 194
Target Start/End: Original strand, 50336192 - 50336331
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | |||||||||| |||||||||  ||| | ||||||||||||| ||||| |||| ||||||  |||||||     
50336192 gttttgatgatacaatacctgatatttggtgcttgatgagcatagaaacttgcttcatgacgatttgcaatggtttgggatgaggattttgacccaaaaa 50336291  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     || |||||||  |||||||| ||||||||||||||||||    
50336292 atcgcactttttgggtttttgaaggtggagggaaagaaaa 50336331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 12656630 - 12656515
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaa-------atttcacacttttgaggtttttggag 178  Q
    ||||||||||||||||||||  || || ||||||||||||||||||| || | ||||||  ||||||       | ||| |||||||  |||||||| ||    
12656630 cttgatgagcgtagaaacttgctttctgacgatttgcaatgatttgggataaggattttgacccaaaaaatcgcacttcgcactttttgggtttttgaag 12656531  T
179 gtggagggaaagaaaa 194  Q
    ||||||||||||||||    
12656530 gtggagggaaagaaaa 12656515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 181
Target Start/End: Original strand, 6599373 - 6599469
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacactttt-gaggtttttggaggtg 181  Q
    |||||| ||| ||||||| |  ||||| |||| ||||||||||||| ||||||||||||| || |||| ||| || |||| | ||||||||||||||    
6599373 cttgataagcatagaaacctgcttcctgacgacttgcaatgatttgaaatgaagatttttaccaaaaaattcgcatttttgggggtttttggaggtg 6599469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Complemental strand, 29348938 - 29348901
Alignment:
168 ggtttttggaggtggagggaaagaaaaaatggagctttg 206  Q
    |||||||||||||||||||||||| ||||||||||||||    
29348938 ggtttttggaggtggagggaaaga-aaaatggagctttg 29348901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 7666689 - 7666870
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||  || |||||    
7666689 gttttgacggtacattacatgttctttgatgcttgatgagcgtagaaacttatttcctgatgatttgcaatgatttggaatgaagattttacccaaaaat 7666788  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||  ||||||||||||||||||||||||||||||||||||| |||||||||| | || |||||||||||||||    
7666789 ttcgcactttttgggtttttggaggtggagggaaagaaaaaatggagcttagtggttgcctgctgggttttgaacaaaaata 7666870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 55 - 236
Target Start/End: Complemental strand, 35995443 - 35995262
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||| || | |||| |||||||     
35995443 gttttgacggtacattacctgttctttgatgcttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttggaataaaaaattttacccaaaaa 35995344  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||| | || |||||||| ||||||    
35995343 ttcacacttttggggtttttggaggtggagggaaagaaaaaatggagctttatgattgcctgctgggttttgaacgaaaata 35995262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 55 - 238
Target Start/End: Complemental strand, 35063272 - 35063090
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    |||||||| ||||||||| | |||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| | ||||||||| ||||||||    
35063272 gttttgacaatacattacctattctttgatacttgatgagcgtagaaacttgtttc-tgacgatttgcaatgatttggattaaagatttttacccaaaat 35063174  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaataat 238  Q
    ||| |||||||| | |||||||||||||||||||||||||||| ||||||||||||||||| | || |||||||| ||||||||    
35063173 ttcgcacttttgggatttttggaggtggagggaaagaaaaaatagagctttgtggttgcctgctgggttttgaacgaaaataat 35063090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 55 - 228
Target Start/End: Complemental strand, 19867090 - 19866917
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||| || |||| |||||||||||||||||||||||  ||||||||    
19867090 gttttgacgatacattacctgttctttgatgcttgatgagcgtagaaacttgtttcctgacaatttacaatgatttggaatgaagattttcacccaaaat 19866991  T
155 ttcacactttt-gaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaa 228  Q
    ||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| | || |||||||    
19866990 ttcgcacttttggaggtttttggaggtggagggaaagaaaaaatggagc-ttgtggttgcctgctgggttttgaa 19866917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 55 - 212
Target Start/End: Original strand, 34086559 - 34086718
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgt--agaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaa 152  Q
    ||||||||| |||||||   |||||||||| ||| || |||||  |||||||| |||||| |||||||||||||||||||||||||||||||| ||||||    
34086559 gttttgacggtacattatccgttctttgatgcttaataagcgtgtagaaacttatttcctgacgatttgcaatgatttggaatgaagatttttacccaaa 34086658  T
153 atttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 212  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||    
34086659 atttcgcacttttggggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 34086718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 55 - 175
Target Start/End: Original strand, 39649705 - 39649825
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| | |||||||| | ||||||||| ||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||| ||||||||    
39649705 gttttgatggtacattacctattctttgatgcttgatgagcgtagaaatttgtttcctgacgatttgcaatgatttggaatgaagatttttacccaaaat 39649804  T
155 ttcacacttttgaggtttttg 175  Q
    ||  ||||||||  |||||||    
39649805 tttgcacttttggagtttttg 39649825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 14443751 - 14443859
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  || ||||  || |||||||  ||||||||||||||||||    
14443751 cttgatgagcgtagaaacttacttcctgacgatttgcaatgatttgggatgaggattttgaccgaaaaaatcgcactttttgggtttttggaggtggagg 14443850  T
186 gaaagaaaa 194  Q
    |||||||||    
14443851 gaaagaaaa 14443859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 54335762 - 54335654
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  ||||||| ||  |||||||  |||||||| |||||||||    
54335762 cttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaatttgcactttttgggtttttgaaggtggagg 54335663  T
186 gaaagaaaa 194  Q
    |||||||||    
54335662 gaaagaaaa 54335654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 55 - 194
Target Start/End: Original strand, 30933795 - 30933934
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  |||||||     
30933795 gttttgatgatacaatacctgatatttggtgcttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaa 30933894  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     |  |||||||  |||||||| ||||||||||||||||||    
30933895 attgcactttttgggtttttgaaggtggagggaaagaaaa 30933934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 11917038 - 11916930
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||| ||||||| |||| ||||||  ||||||| ||| |||||||  |||||||| |||||||||    
11917038 cttgatgagcgtagaaacttgcttcctgacgatttgcaaagatttgggatgaggattttgacccaaaaattcgcactttttgggtttttgaaggtggagg 11916939  T
186 gaaagaaaa 194  Q
    |||| ||||    
11916938 gaaaaaaaa 11916930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 55 - 194
Target Start/End: Original strand, 20518049 - 20518188
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | ||||||||||||||||||||  ||| | ||||||| ||||| ||||| |||| ||||||  |||||||     
20518049 gttttgatgatacaatacctgatatttggtgcttgatgagcgtagaaacttgcttcatgacgatttacaatgctttgggatgaggattttgacccaaaaa 20518148  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    ||| |||||||  |||||||| ||||||||||||||||||    
20518149 ttcgcactttttgggtttttgaaggtggagggaaagaaaa 20518188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 87 - 194
Target Start/End: Complemental strand, 30528604 - 30528497
Alignment:
87 ttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggaggg 186  Q
    ||||||||  |||||||||  ||||| ||||||||||||||||| |||||||||||||   ||||||  || |||||||  |||||||||||||||||||    
30528604 ttgatgagtatagaaacttgcttcctgacgatttgcaatgatttagaatgaagattttgatccaaaaaatcgcactttttgggtttttggaggtggaggg 30528505  T
187 aaagaaaa 194  Q
    ||||||||    
30528504 aaagaaaa 30528497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 53767363 - 53767224
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | ||||||||||||||||||||  ||| | ||||||||||||||||||| ||||  |||||  |||||||     
53767363 gttttgatgatacaatacatgatatttggtgcttgatgagcgtagaaacttgcttcatgacgatttgcaatgatttgggatgagaattttgacccaaaaa 53767264  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     | ||||||||  |||||||| ||||||||||||||||||    
53767263 attacactttttgggtttttgaaggtggagggaaagaaaa 53767224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1063 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: scaffold1063
Description:

Target: scaffold1063; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 55 - 235
Target Start/End: Complemental strand, 1782 - 1601
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||| ||| |||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||     
1782 gttttgacggtacattacatgttcttcgatgcttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttggaataaagatttttgcccaaaaa 1683  T
155 ttcacacttttgaggtttttggaggtggagggaaagaa-aaaatggagctttgtggttgcctacaggattttgaacaaaaat 235  Q
    ||| |||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||   ||||||||||| |||||    
1682 ttcgcacttttggggtttttggaggtggagggaaagaaaaaaatggagctttatggttgcctggcggattttgaacgaaaat 1601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 12)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 763105 - 763285
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| | ||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||  |||||||    
763105 gttttgacgctacattacctattctttgatgcttgatgagcgtagaaatttgtttcctaacgatttgcaatgatttggaatgaagatttttatccaaaat 763204  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||| |  ||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||    
763205 ttcgcacttttg-gaattttgaaggtggagggaaagaaaaaatggagctttgtggttgcctgctggattttgaacgaaaata 763285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 65 - 236
Target Start/End: Original strand, 30491525 - 30491697
Alignment:
65 tacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttt 164  Q
    |||||||| ||||||||||| |||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||  | ||||||||| ||||||    
30491525 tacattacctgttctttgatgcttgatgagcgtagaaacttgtctcctgacgatttgcaatgatttggaatgaagattttgactcaaaatttcgcacttt 30491624  T
165 t-gaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    | | |||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||| ||||||    
30491625 tgggggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctgctgggttttgaacgaaaata 30491697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 55 - 211
Target Start/End: Original strand, 34017399 - 34017555
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| ||||||||    
34017399 gttttgacgatacattacatgttctttgatgcttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttgaaatgaagatttttacccaaaat 34017498  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggtt 211  Q
    ||  ||||||||   ||||||||||||||| ||||||||||||||| ||||||||||    
34017499 tttgcacttttggaatttttggaggtggagtgaaagaaaaaatggaactttgtggtt 34017555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 57 - 212
Target Start/End: Complemental strand, 38739690 - 38739536
Alignment:
57 tttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaattt 156  Q
    ||||||| |||||||| ||||||||||| |||||||||||||||| ||| |||||| ||||||||||||||||| |||||||||||||  ||||||| ||    
38739690 tttgacggtacattacctgttctttgatgcttgatgagcgtagaa-cttgtttcctgacgatttgcaatgatttagaatgaagattttgacccaaaaatt 38739592  T
157 cacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 212  Q
    | |||||||  |||||||||||||||||||||||||||||||||||||||||||||    
38739591 ctcactttttgggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 38739536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 55 - 212
Target Start/End: Complemental strand, 5505068 - 5504917
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| | |||||||| ||||||||||| |||||||||||||||||| | ||| || ||||||||||||||||    |||||||||||| ||||||||    
5505068 gttttgatggtacattacctgttctttgattcttgatgagcgtagaaacctgttttctgacgatttgcaatgatt----atgaagatttttacccaaaat 5504973  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 212  Q
    ||  ||||||||  ||||||||||||||||||||  ||||||||||||||||||||||    
5504972 tttgcacttttggagtttttggaggtggagggaa--aaaaaatggagctttgtggttg 5504917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 235
Target Start/End: Original strand, 33143948 - 33144085
Alignment:
99 gaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaag-aaaaaat 197  Q
    ||||||| ||| || |||||||||||||||||||||||||||||||  ||||||||||| || ||||| || |||||||||||||||||||| |||||||    
33143948 gaaacttgttttctgacgatttgcaatgatttggaatgaagattttcacccaaaatttcgcatttttgggggttttggaggtggagggaaagaaaaaaat 33144047  T
198 ggagctttgtggttgcctacaggattttgaacaaaaat 235  Q
    |||| |||||||||| || | || |||||||| |||||    
33144048 ggagttttgtggttgtctgctgggttttgaaccaaaat 33144085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 20887698 - 20887806
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    |||||| |||||||||||||| ||||| ||||||||||||||||||| |||| ||||||  | |||||  || |||||||  |||||||| ||||| |||    
20887698 cttgataagcgtagaaactttcttcctgacgatttgcaatgatttgggatgaggattttgactcaaaaaatcccactttttgggtttttgaaggtgtagg 20887797  T
186 gaaagaaaa 194  Q
    |||||||||    
20887798 gaaagaaaa 20887806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 32910724 - 32910585
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | ||||||||| ||||||||||  ||| | ||||||||||||| ||||| ||||  |||||  |||||||     
32910724 gttttgatgatacaatacctgatatttggtgcttgatgagtgtagaaacttgcttcatgacgatttgcaatggtttgggatgagaattttgacccaaaaa 32910625  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    ||| |||||||  |||||||| ||||||||||||||||||    
32910624 ttcgcactttttgggtttttgaaggtggagggaaagaaaa 32910585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 153
Target Start/End: Original strand, 15235047 - 15235137
Alignment:
63 gatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaa 153  Q
    ||||||||||||| | |||||| ||||||||| |||  |||||  || || |||||||||||||||||||||||||||||||  |||||||    
15235047 gatacattacttgatatttgatgcttgatgagtgtatgaacttgctttctgacgatttgcaatgatttggaatgaagattttgacccaaaa 15235137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 109 - 195
Target Start/End: Complemental strand, 16109403 - 16109318
Alignment:
109 tcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaagaaaaa 195  Q
    |||| ||||||| |||| ||||||||||||||||||  |||||||  || |||||||  ||||||||||||||||||||||||||||    
16109403 tcctgacgattt-caataatttggaatgaagattttgacccaaaaaatcgcactttttgggtttttggaggtggagggaaagaaaaa 16109318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 29195858 - 29195966
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  || || ||||||||||||||||||| |||| ||| ||  || ||||  |  |||||||  |||||||| |||||||||    
29195858 cttgatgagcgtagaaacttgctttctgacgatttgcaatgatttgggatgaggatattgacctaaaaaattgcactttttgggtttttgaaggtggagg 29195957  T
186 gaaagaaaa 194  Q
    |||||||||    
29195958 gaaagaaaa 29195966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 116 - 194
Target Start/End: Original strand, 8736470 - 8736550
Alignment:
116 gatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtg--gagggaaagaaaa 194  Q
    |||||||||||||||| ||||||||||||    ||||| ||  |||||||  ||||||||||||||  |||||||||||||    
8736470 gatttgcaatgatttgaaatgaagattttgattcaaaaatttgcactttttgggtttttggaggtggagagggaaagaaaa 8736550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 33402866 - 33403047
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| ||| |||||||||||||||| |||||  | |||||||||||||||||||||||||||||| ||||||||    
33402866 gttttgacggtacattacctgttctttgatgcttaatgagcgtagaaacttgtttccggaagatttgcaatgatttggaatgaagatttttacccaaaat 33402965  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||| ||||||| ||||||||| |||||||||||||||| ||| ||||||||| | ||||||||||| ||||||    
33402966 ttcgcacttttggggtttttagaggtggagcgaaagaaaaaatggagttttatggttgcctgctggattttgaacgaaaata 33403047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 35577246 - 35577426
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||  |||||| || |||||    
35577246 gttttgacggtacattacctgttctttgatgcttgatgagcgtagaaacttgtttcctaacgatttgcaatgatttggaatgagtatttttaccaaaaat 35577345  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| |||||||| |||||||||||||||| | |||||||||| |||||| ||||||||||| | || |||||||| ||||||    
35577346 ttcgcacttttggggtttttggaggtggacgaaaagaaaaaa-ggagctctgtggttgcctgctgggttttgaacgaaaata 35577426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 55 - 236
Target Start/End: Complemental strand, 48025894 - 48025714
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||  |||||||| ||||||||||| |||||||||| ||||||||| |||| | | |||||||||||||||||||||||||||||| ||||||||    
48025894 gttttgacagtacattacctgttctttgatgcttgatgagcatagaaacttgtttcttgatgatttgcaatgatttggaatgaagatttttacccaaaat 48025795  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcct-acaggattttgaacaaaaata 236  Q
    ||| |||||||| || |||||||||||||||||||||||||||||||||||||||||| || | ||| |||||||||||||||    
48025794 ttcgcacttttg-gggttttggaggtggagggaaagaaaaaatggagctttgtggttgtctgatagg-ttttgaacaaaaata 48025714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 55 - 212
Target Start/End: Complemental strand, 25817755 - 25817598
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| |||||||| |||||| |||| ||||| ||||| ||||||||  ||  | ||||||||||||||||||||| |||||||||  |||||||     
25817755 gttttgacggtacattacctgttctatgatgcttgacgagcgcagaaacttgctttatgacgatttgcaatgatttggaacgaagattttgacccaaaaa 25817656  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttg 212  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||| ||||||||    
25817655 ttcacactttttgggtttttggaggtggagggaaagaaaaaatggagctgtgtggttg 25817598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 55 - 195
Target Start/End: Complemental strand, 3368376 - 3368236
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| ||||||||||||| | |||||| |||||| || ||||||||||  ||||| | ||||||||||||||  |||||||||||||  ||||||      
3368376 gttttgatgatacattacttgatgtttgatgcttgataagtgtagaaacttgcttcctgatgatttgcaatgattatgaatgaagattttgacccaaata 3368277  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaa 195  Q
     || |||||||  ||||||||||||||||||||||||||||    
3368276 atcgcactttttgggtttttggaggtggagggaaagaaaaa 3368236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 16315158 - 16315266
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||||||||||| |||||||||||   ||||||  || |||||||  ||||| || |||||||||    
16315158 cttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaagattttgatccaaaaaatcgcactttttgggtttgtgaaggtggagg 16315257  T
186 gaaagaaaa 194  Q
    |||||||||    
16315258 gaaagaaaa 16315266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 12063668 - 12063560
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||| ||||||||||  ||||| ||||||||||||||||||| |||| ||||||  |||||||  ||||||||||  |||||||| |||  ||||    
12063668 cttgatgagtgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaaatcacactttttgggtttttgaaggaagagg 12063569  T
186 gaaagaaaa 194  Q
    |||||||||    
12063568 gaaagaaaa 12063560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 23941774 - 23941635
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | |||||||| |||||||||||  ||||| ||||||||||||||||||| |||| | ||||  |||||||     
23941774 gttttgatgatacaatacctgatatttggtgcttgatgaacgtagaaacttgcttcctgacgatttgcaatgatttgggatgagggttttgacccaaaaa 23941675  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     |  |||||||  |||||||| ||||||||||||||||||    
23941674 attgcactttttgggtttttgaaggtggagggaaagaaaa 23941635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 90 - 194
Target Start/End: Original strand, 30704342 - 30704446
Alignment:
90 atgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaa 189  Q
    ||||| ||||||||||  ||||| ||||||||||||||||||  ||||  |||||  |||||||  || |||||||  |||||||| |||||||||||||    
30704342 atgagtgtagaaacttgcttcctgacgatttgcaatgatttgagatgagaattttgacccaaaaagtcgcactttttgggtttttgaaggtggagggaaa 30704441  T
190 gaaaa 194  Q
    |||||    
30704442 gaaaa 30704446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 87 - 130
Target Start/End: Original strand, 18426397 - 18426440
Alignment:
87 ttgatgagcgtagaaacttttttcctaacgatttgcaatgattt 130  Q
    |||||||||||||||||||  ||||| |||||||||||||||||    
18426397 ttgatgagcgtagaaacttgcttcctgacgatttgcaatgattt 18426440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: scaffold0037
Description:

Target: scaffold0037; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 38109 - 38289
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||  |||||||  ||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||     
38109 gttttgactgtacattatatgttctttgatgcttgatgagcgtagaaacttgtttcctgacgatttgcaatgatttggaatgaagatttttacccaaaaa 38208  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||  |||||||  | ||||||||||||||||||||| |||||||||||| ||||||||| ||| ||||||||||| ||||||    
38209 tttgcactttttggctttttggaggtggagggaaag-aaaaatggagctgtgtggttgcatactggattttgaacgaaaata 38289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 55 - 236
Target Start/End: Complemental strand, 34276548 - 34276368
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||||| ||||| || |||||||||||  |||||| |||||||||||| |||| | |||||||||||||||||||||||||||||||| ||||||||    
34276548 gttttgacggtacatcacctgttctttgatggttgatgggcgtagaaacttgtttcatgacgatttgcaatgatttggaatgaagatttttacccaaaat 34276449  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    ||| | |||||| ||||||||||||||||||| || ||||||| ||||||||||||||||| | || |||||||| ||||||    
34276448 ttctctcttttggggtttttggaggtggaggggaa-aaaaaattgagctttgtggttgcctgctgggttttgaacgaaaata 34276368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 14189890 - 14189780
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggt--gga 183  Q
    |||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||  |||||||  ||||||||||   | ||||||||||  |||    
14189890 cttgatgagcgtagtaactttcttcctaacgatttgcaatgatttgaaatgaagattttgacccaaaaaatcacactttttgagattttggaggtaggga 14189791  T
184 gggaaagaaaa 194  Q
    |||||||||||    
14189790 gggaaagaaaa 14189780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 194
Target Start/End: Original strand, 24626064 - 24626172
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||| | | |||||||||||||||||||||||||||||| |||||||  |  |||||||   ||||||||||||| |||    
24626064 cttgatgagcgtagaaacttgcttcatgatgatttgcaatgatttggaatgaagatttttacccaaaaaattgcactttttgtgtttttggaggtgcagg 24626163  T
186 gaaagaaaa 194  Q
    |||||||||    
24626164 gaaagaaaa 24626172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 236
Target Start/End: Complemental strand, 33228370 - 33228293
Alignment:
159 cacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    |||||||  |||||||||||||||||| ||||||||||||||||||||||||||||| | || |||||||| ||||||    
33228370 cactttttgggtttttggaggtggaggaaaagaaaaaatggagctttgtggttgcctgctgggttttgaacgaaaata 33228293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 55 - 195
Target Start/End: Original strand, 2807157 - 2807296
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||||||| |||||||||||  |||| |||||||  |||||  |||||||||||||||||||||||  ||||||||||||  |||||||     
2807157 gttttgatgatacattacctgttctttgatgtttgacgagcgtaagaacttgcttcctaacgatttgcaatgatttcaaatgaagattttgacccaaaaa 2807256  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaa 195  Q
     |   ||||||  || |||| ||||||||||||||||||||    
2807257 attgtactttt-tgggttttagaggtggagggaaagaaaaa 2807296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 165
Target Start/End: Complemental strand, 32075156 - 32075054
Alignment:
63 gatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacact 162  Q
    |||||||||| || | |||||| ||||||||||||||||||||  ||||| | ||||| ||||||||||| |||| ||||||  ||||||| ||||||||    
32075156 gatacattacctgatatttgatgcttgatgagcgtagaaacttgcttcctgatgatttacaatgatttgggatgaggattttgacccaaaaattcacact 32075057  T
163 ttt 165  Q
    |||    
32075056 ttt 32075054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 63 - 146
Target Start/End: Original strand, 20532099 - 20532182
Alignment:
63 gatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttg 146  Q
    |||||||||| || | |||||| ||||||||||||||||||||  ||||  || |||||||||||||||||||||| |||||||    
20532099 gatacattacctggtatttgatgcttgatgagcgtagaaacttgcttccatacaatttgcaatgatttggaatgaaaatttttg 20532182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 194
Target Start/End: Original strand, 13868202 - 13868319
Alignment:
79 tttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggag 178  Q
    |||||| ||||||||| ||||||||||  ||||  |||||||||||||||||| |||||||| |||  ||||||| ||  |||||||   ||||||||||    
13868202 tttgatgcttgatgagtgtagaaacttacttccccacgatttgcaatgatttgaaatgaagaatttgacccaaaaatttgcactttttgagtttttggag 13868301  T
179 gtg--gagggaaagaaaa 194  Q
    |||  |||||||||||||    
13868302 gtggagagggaaagaaaa 13868319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 194
Target Start/End: Original strand, 20534374 - 20534421
Alignment:
147 cccaaaatttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    ||||||||||| |||||||  |||||||| ||||||||||||||||||    
20534374 cccaaaatttcgcactttttgggtttttgaaggtggagggaaagaaaa 20534421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 41601191 - 41601120
Alignment:
123 aatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    |||||||||| |||| ||||||  |||||||  || |||||||  |||||||| ||||||||||||||||||    
41601191 aatgatttgggatgaggattttgacccaaaaaatcgcactttttgggtttttgaaggtggagggaaagaaaa 41601120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 12)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 55 - 215
Target Start/End: Original strand, 2369658 - 2369818
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||||||| ||||||||||| ||||||||| ||||||||||  ||| | |||||||||||||||||||||||||||||||  |||||||     
2369658 gttttgaggatacattacctgttctttgatgcttgatgagtgtagaaacttgcttcatgacgatttgcaatgatttggaatgaagattttgacccaaaaa 2369757  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcct 215  Q
    |||||||||||  ||||||| |||||||||||||||||||||||||| | |||||||||||    
2369758 ttcacactttttgggtttttagaggtggagggaaagaaaaaatggagttgtgtggttgcct 2369818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 55 - 226
Target Start/End: Original strand, 4452382 - 4452553
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    |||||||  ||| ||||| ||||||||||| ||||||||  ||||||||||  ||||| | |||||||||| ||||||||||||||||||  |||||||     
4452382 gttttgagaatatattacctgttctttgatgcttgatgaatgtagaaacttgcttcctgatgatttgcaattatttggaatgaagattttgacccaaaaa 4452481  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttg 226  Q
    ||| |||||||  ||||||||||| |||||||||||||||||||||| | ||||||||||| | ||||||||    
4452482 ttcgcactttttgggtttttggagatggagggaaagaaaaaatggagttgtgtggttgcctgctggattttg 4452553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 116 - 226
Target Start/End: Original strand, 4452765 - 4452873
Alignment:
116 gatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcct 215  Q
    |||||||||| ||||||||||||||||||  ||||||| ||  ||||||| |||||||||||||||||||||||||||||||||||  ||||||||||||    
4452765 gatttgcaattatttggaatgaagattttgacccaaaaatttgcactttttaggtttttggaggtggagggaaagaaaaaatggag--ttgtggttgcct 4452862  T
216 acaggattttg 226  Q
     | ||||||||    
4452863 gctggattttg 4452873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 44222148 - 44222009
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||||| ||||||||||||||||||||  ||||| ||||||||||||||||||| |||| ||||||  |||||||     
44222148 gttttgatgatacaatacctgatatttgatgcttgatgagcgtagaaacttgcttcctgacgatttgcaatgatttgggatgaggattttgacccaaaaa 44222049  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     || |||||||  |||||||| ||||||||||||||||||    
44222048 atcgcactttttgggtttttgaaggtggagggaaagaaaa 44222009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 23941482 - 23941343
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | ||||||||||||||||||||  ||| | ||||||||||||||||||| |||| ||||||  || ||||     
23941482 gttttgatgatacaatacctgatatttggtgcttgatgagcgtagaaacttgcttcatgacgatttgcaatgatttgggatgaggattttgaccaaaaaa 23941383  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    ||| |||||||  |||||||| ||||||||||||||||||    
23941382 ttcgcactttttgggtttttgaaggtggagggaaagaaaa 23941343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 4278711 - 4278602
Alignment:
86 cttgatgagcgtagaaacttt-tttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggag 184  Q
    ||||||||||||||||||||  |||||| ||||| ||||||||||||| |||| ||||||  || |||| ||| |||||||| |||||||| ||||||||    
4278711 cttgatgagcgtagaaacttactttcctgacgatgtgcaatgatttgggatgaggattttgaccaaaaaattctcacttttggggtttttgaaggtggag 4278612  T
185 ggaaagaaaa 194  Q
    ||||||||||    
4278611 ggaaagaaaa 4278602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 155 - 236
Target Start/End: Original strand, 10526856 - 10526937
Alignment:
155 ttcacacttttgaggtttttggaggtggagggaaagaaaaaatggagctttgtggttgcctacaggattttgaacaaaaata 236  Q
    |||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||| | || |||||| | ||||||    
10526856 ttcacactttttggatttttggaggtggagggaaagaaaaaatggagctttgtggttgcctgctgggttttgatcgaaaata 10526937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 11356478 - 11356339
Alignment:
55 gttttgacgatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaat 154  Q
    ||||||| |||||| ||| || | |||| | |||||||| |||||||||||  ||||| | ||||||||||||||||| ||||  |||||  |||||||     
11356478 gttttgatgatacaatacctgatatttggtgcttgatgaacgtagaaacttgcttcctgatgatttgcaatgatttgggatgagaattttgacccaaaaa 11356379  T
155 ttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
     || |||||||  |||||||| ||||||||||||||||||    
11356378 atcgcactttttgggtttttgaaggtggagggaaagaaaa 11356339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 194
Target Start/End: Original strand, 13070509 - 13070579
Alignment:
124 atgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaagaaaa 194  Q
    |||||||||||||||||||||  |||||||  ||||||||||  |||||||||||||||||||||||||||    
13070509 atgatttggaatgaagattttgacccaaaaaatcacactttttgggtttttggaggtggagggaaagaaaa 13070579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 86 - 144
Target Start/End: Complemental strand, 12868722 - 12868664
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttt 144  Q
    ||||||||| ||||||||||  ||||| |||||||| ||||||||| ||||||||||||    
12868722 cttgatgagtgtagaaacttacttcctcacgatttgtaatgatttgaaatgaagatttt 12868664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 87 - 194
Target Start/End: Complemental strand, 31731015 - 31730907
Alignment:
87 ttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtg--gag 184  Q
    |||||||| ||||||||||  ||||| ||||||||||||||| || ||||||||| ||  |||| || ||| |||| ||  ||||||||||||||  |||    
31731015 ttgatgagtgtagaaacttgcttcctgacgatttgcaatgatatgaaatgaagatattgacccacaa-ttcgcactctttgggtttttggaggtggagag 31730917  T
185 ggaaagaaaa 194  Q
    ||||||||||    
31730916 ggaaagaaaa 31730907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 127
Target Start/End: Original strand, 23562298 - 23562362
Alignment:
63 gatacattacttgttctttgatacttgatgagcgtagaaacttttttcctaacgatttgcaatga 127  Q
    ||||||||||||| | ||| || ||||||||||||||||||||  || ||||||||||| |||||    
23562298 gatacattacttgatttttaatgcttgatgagcgtagaaacttgctttctaacgatttgaaatga 23562362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0599 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0599
Description:

Target: scaffold0599; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 194
Target Start/End: Complemental strand, 8789 - 8681
Alignment:
86 cttgatgagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagg 185  Q
    ||||||||||||||||||||  ||||| ||||||||||| ||||||| |||| ||||||  ||||||| ||| |||||||  |||||||| |||||||||    
8789 cttgatgagcgtagaaacttgcttcctgacgatttgcaaagatttgggatgaggattttgacccaaaaattcgcactttttgggtttttgaaggtggagg 8690  T
186 gaaagaaaa 194  Q
    |||| ||||    
8689 gaaaaaaaa 8681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1050 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1050
Description:

Target: scaffold1050; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 92 - 194
Target Start/End: Complemental strand, 2163 - 2061
Alignment:
92 gagcgtagaaacttttttcctaacgatttgcaatgatttggaatgaagatttttgcccaaaatttcacacttttgaggtttttggaggtggagggaaaga 191  Q
    ||||||||||||||  ||||| |||||||||||||||||   ||||  |||||| |||||||  || |||||||  |||||||  |||||||||||||||    
2163 gagcgtagaaacttgcttcctgacgatttgcaatgatttaagatgagcatttttacccaaaaaatcgcactttttgggtttttaaaggtggagggaaaga 2064  T
192 aaa 194  Q
    |||    
2063 aaa 2061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University