View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19926_low_6 (Length: 204)
Name: NF19926_low_6
Description: NF19926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19926_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 23 - 177
Target Start/End: Complemental strand, 52799299 - 52799145
Alignment:
| Q |
23 |
acgtgtaagccggaaaaagatggagggctaggtattagagatttggggttcatgaatctagctctttttgcaaagtggagatgaaagttattagttgaga |
122 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52799299 |
acgtgtaagccggaaaaagatgaagggctaggtattacagatttagggttcatgaatctagctctttttgcaaagtggagatgaaagttattagttgaga |
52799200 |
T |
 |
| Q |
123 |
ggggttctttgtggattgctaaacatggcgattgtgtcgtgttggtctagatgta |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52799199 |
ggggttctttgtggattgctaaacatggtgattgtgtcgtgttggtctagatgta |
52799145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University