View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_112 (Length: 246)
Name: NF19927_high_112
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_112 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 14 - 132
Target Start/End: Complemental strand, 2260287 - 2260169
Alignment:
| Q |
14 |
cacagacattagtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaatcaatccccagtttcttatagtccataaactctctctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260287 |
cacagacattagtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaatcaatccccagtttcttatagtccataaactctctctc |
2260188 |
T |
|
| Q |
114 |
catcctgaataaattcacg |
132 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2260187 |
catcctgaataaattcacg |
2260169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 2260107 - 2260071
Alignment:
| Q |
194 |
cttaattaggaaattaataagagattgaatgattatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260107 |
cttaattaggaaattaataagagattgaatgattatt |
2260071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 76
Target Start/End: Original strand, 44733780 - 44733831
Alignment:
| Q |
25 |
gtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaat |
76 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || || || |||||||||| |
|
|
| T |
44733780 |
gtcactcttttagcaccaatgcttgagctgctaccaatgaattgattcaaat |
44733831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University