View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_high_116 (Length: 238)

Name: NF19927_high_116
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_high_116
NF19927_high_116
[»] chr4 (1 HSPs)
chr4 (19-124)||(50387304-50387409)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 50387409 - 50387304
Alignment:
19 ccaactgatatattttcttttcctttctaatacattatctttgtgttgtcttgatgtatatgacttcacattgtcgatcatttaattaagtttgtccaga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50387409 ccaactgatatattttcttttcctttctaatacattatctttgtgttgtcttgatgtatatgacttcacattgtcgatcatttaattaagtttgtccaga 50387310  T
119 tattat 124  Q
    ||||||    
50387309 tattat 50387304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University