View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_118 (Length: 237)
Name: NF19927_high_118
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_118 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 24236937 - 24237147
Alignment:
| Q |
1 |
aggctaacatctaagatcactccctcactcacttttaaacttgatcatcgcaaaattttccacccattctatcctgaacagctttcactgctgcaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24236937 |
aggctaacatctaagatcactccctcactcacttttaaacttgatcatcgcaaaattttccacccattctatcctgaacagctttcacagctgcaactct |
24237036 |
T |
|
| Q |
101 |
agcagcagtggcggccctgtttgctgccattactgctttctccacttggtcatcattccggggatggtttatcgcattttctgcagttctcctagcagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24237037 |
agcagcagtggcggccctgtttgctgccattactgctttctccacttggtcatcattccggggatggtttatcgcattttctgcggttctcctagcagcc |
24237136 |
T |
|
| Q |
201 |
tgcaattttaa |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
24237137 |
tgcaattttaa |
24237147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 51 - 124
Target Start/End: Original strand, 32692713 - 32692786
Alignment:
| Q |
51 |
caaaattttccacccattctatcctgaacagctttcactgctgcaactctagcagcagtggcggccctgtttgc |
124 |
Q |
| |
|
|||||||||||| |||| || | ||||||||| ||||| || ||||||||||||||||||||||| ||||||| |
|
|
| T |
32692713 |
caaaattttccatccatcctgttctgaacagccttcacagcagcaactctagcagcagtggcggctttgtttgc |
32692786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University