View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_131 (Length: 228)
Name: NF19927_high_131
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_131 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 30173713 - 30173908
Alignment:
| Q |
18 |
aacatgtctgagatgctatgcttgtgccggcaaccggtggtgagctgccggaaatgtttgcttacagaaatatgcgatcgattagtgaatcttggcttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30173713 |
aacatgtctgagatgctatgcttgtgccggcaaccggtggtgagctgccggaaatgtttgcttacagaaatatgcgatcgattagtgaatcttggcttca |
30173812 |
T |
|
| Q |
118 |
attccgcaatttgcaaatctaaatggaaaagttcatccgagattccatcaggtatataaatatttacatgattcacttgttcttttacaagatatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30173813 |
attccgcaatttgcaaatctaaatggaagagttcatccgagattccatcaggtatatacatatttacatgattcacttgttcttttacaagatatt |
30173908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 72 - 206
Target Start/End: Original strand, 12359999 - 12360133
Alignment:
| Q |
72 |
tgtttgcttacagaaatatgcgatcgattagtgaatcttggcttcaattccgcaatttgcaaatctaaatg-gaaaagttcatccgagattccatcaggt |
170 |
Q |
| |
|
|||||||| | ||||||||| |||| ||| ||||| | ||||||| ||||| ||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
12359999 |
tgtttgctcagagaaatatgtgatcaattgttgaatgt-ggcttcatttccggaatttgcaaatctaaattagggtagttcatccgagattccatcaggt |
12360097 |
T |
|
| Q |
171 |
atataaatatttacatgattcacttgttcttttaca |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12360098 |
atatacatatttacatgattcacttgttcttttaca |
12360133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University