View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_high_132 (Length: 227)

Name: NF19927_high_132
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_high_132
NF19927_high_132
[»] chr5 (1 HSPs)
chr5 (23-204)||(41928398-41928581)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 23 - 204
Target Start/End: Complemental strand, 41928581 - 41928398
Alignment:
23 ttatatataattggcgtgaagcagcagttata--annnnnnncaaaatccagacataaatgcttgctagctataaataatagcactctttgttttactaa 120  Q
    ||||||||||||||||||||||||||||||||  |       ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||    
41928581 ttatatataattggcgtgaagcagcagttatataatttttttcaaaatccaaacataaatgcttgctagctataaataatagcactatttgttttactaa 41928482  T
121 tatgtttcttttcatgaacttcattaaacagtttgagtatagtatgtgtataatcaatgagagtgagagaaaattaaacactta 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41928481 tatgtttcttttcatgaacttcattaaacagtttgagtatagtatgtgtataatcaatgagagtgagagaaaattaaacactta 41928398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University