View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_132 (Length: 227)
Name: NF19927_high_132
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_132 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 23 - 204
Target Start/End: Complemental strand, 41928581 - 41928398
Alignment:
| Q |
23 |
ttatatataattggcgtgaagcagcagttata--annnnnnncaaaatccagacataaatgcttgctagctataaataatagcactctttgttttactaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41928581 |
ttatatataattggcgtgaagcagcagttatataatttttttcaaaatccaaacataaatgcttgctagctataaataatagcactatttgttttactaa |
41928482 |
T |
|
| Q |
121 |
tatgtttcttttcatgaacttcattaaacagtttgagtatagtatgtgtataatcaatgagagtgagagaaaattaaacactta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41928481 |
tatgtttcttttcatgaacttcattaaacagtttgagtatagtatgtgtataatcaatgagagtgagagaaaattaaacactta |
41928398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University