View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_133 (Length: 225)
Name: NF19927_high_133
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_133 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 49461049 - 49461236
Alignment:
| Q |
19 |
ttaactttatgccacaatgacgacaatggcatggccccatctcttgagaaagcataagccatcctgcataaattttaaccattataagtaaatatacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461049 |
ttaactttatgccacaatgacgacaatggcatggccccatctcttgagaaagcataagccatcctgcataaattttaaccattataagtaaatatacaaa |
49461148 |
T |
|
| Q |
119 |
ttgaattcctcttctcgtatggaaaactcactaagagatgctggtacagttaccttgaattggctgtaactgaacccataccacagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461149 |
ttgaattcctcttctcgtatggaaaactcactaagagatgctggtacagttaccttgaattggctgtaactgaacccataccacagaa |
49461236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 49468107 - 49468187
Alignment:
| Q |
19 |
ttaactttatgccacaatgacgacaatggcatggccccatctcttgagaaagcataagccatcctgcataaattttaacca |
99 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||| ||||| || |||||||||||||||||| | |||||||||||| |
|
|
| T |
49468107 |
ttaactttatgccacaaagatgaaaatggcattgccccgtctctcgaaaaagcataagccatcctgtacaaattttaacca |
49468187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University