View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_137 (Length: 219)
Name: NF19927_high_137
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_137 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 45 - 195
Target Start/End: Original strand, 49254815 - 49254965
Alignment:
| Q |
45 |
atgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactttc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49254815 |
atgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactttc |
49254914 |
T |
 |
| Q |
145 |
tctttctagcacagctattgctatctctctttgtgctgtctctggcttcag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
49254915 |
tctttctagcacagctattgctatctctctctgtgttgtctctggcttcag |
49254965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 43 - 197
Target Start/End: Complemental strand, 49274763 - 49274605
Alignment:
| Q |
43 |
atatgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactt |
142 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49274763 |
atatgttggttttctagctttgcctatgactagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactt |
49274664 |
T |
 |
| Q |
143 |
tctctttctagcacagctat----tgctatctctctttgtgctgtctctggcttcagcc |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49274663 |
tctctttctagcacagctattgcttgctatctctctttgtgctgtctctggcttcagcc |
49274605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 45 - 195
Target Start/End: Original strand, 49271483 - 49271633
Alignment:
| Q |
45 |
atgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactttc |
144 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49271483 |
atgttggttttctagctttgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaacttgc |
49271582 |
T |
 |
| Q |
145 |
tctttctagcacagctattgctatctctctttgtgctgtctctggcttcag |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | || ||||||||||||||| |
|
|
| T |
49271583 |
tctttctaccacagctattgctatctctctctatggtgtctctggcttcag |
49271633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 45 - 195
Target Start/End: Original strand, 49267077 - 49267227
Alignment:
| Q |
45 |
atgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactttc |
144 |
Q |
| |
|
|||||||||||||||| |||||||||| || ||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| | |
|
|
| T |
49267077 |
atgtttgttttctagctctgcctatgatcgccgtcactctgtcacaatattttctacaaattatttcaatgataatggttggtcgtttgggtaaacttgc |
49267176 |
T |
 |
| Q |
145 |
tctttctagcacagctattgctatctctctttgtgctgtctctggcttcag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
49267177 |
tctttctagcacagctattgctatctctctctgtggtgtctctggcttcag |
49267227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University