View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_high_139 (Length: 211)

Name: NF19927_high_139
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_high_139
NF19927_high_139
[»] chr5 (1 HSPs)
chr5 (15-195)||(22660330-22660510)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 22660330 - 22660510
Alignment:
15 aatatgggcatcaggcattcttctaatcacagcatatgcccaacaaggaactttctcccttcaacaagccaaaactatgaacagacacctaaccaaatca 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||     
22660330 aatatgggcatcaggcattcttctaatcacagcatatgcccaacaaggaactttctcccttcaacaagccaaaactatgaacagacacctaaccaagtcc 22660429  T
115 ttcgaaatcccagcagggtccatgtcggtattcaccatcctcacaatgctcttcactactgccctctatgaccgtgtctta 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22660430 ttcgaaatcccagcagggtccatgtcggtattcaccatcctcacaatgctcttcactactgccctctatgaccgtgtctta 22660510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University