View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_139 (Length: 211)
Name: NF19927_high_139
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_139 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 22660330 - 22660510
Alignment:
| Q |
15 |
aatatgggcatcaggcattcttctaatcacagcatatgcccaacaaggaactttctcccttcaacaagccaaaactatgaacagacacctaaccaaatca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22660330 |
aatatgggcatcaggcattcttctaatcacagcatatgcccaacaaggaactttctcccttcaacaagccaaaactatgaacagacacctaaccaagtcc |
22660429 |
T |
 |
| Q |
115 |
ttcgaaatcccagcagggtccatgtcggtattcaccatcctcacaatgctcttcactactgccctctatgaccgtgtctta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22660430 |
ttcgaaatcccagcagggtccatgtcggtattcaccatcctcacaatgctcttcactactgccctctatgaccgtgtctta |
22660510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University