View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_142 (Length: 202)
Name: NF19927_high_142
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_142 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 178
Target Start/End: Original strand, 5795806 - 5795968
Alignment:
| Q |
16 |
atggcactctatgccccccnnnnnnngaaagtagaggacatgttgctcaagataaccttcatactacacaagttctctgcacatactcctccagtaaata |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
5795806 |
atggcactctatgccccccaaaaaaagaaagtagaggacatgttgctgaagataaccttcatactacacaagttctctgcacatgctcctccaataaata |
5795905 |
T |
 |
| Q |
116 |
gagtggcatccgcatattggagatgtgaaacatatccttggagttaggaagcctaaacccctt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5795906 |
gagtggcatccgcatattggagatgtgaaacatatccttggagttaggaagcctaaacccctt |
5795968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University