View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_15 (Length: 543)
Name: NF19927_high_15
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 7e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 6 - 173
Target Start/End: Complemental strand, 10957620 - 10957453
Alignment:
| Q |
6 |
gtgagatgaacaaaactcgttaaagattgtgaagcaatatagagatgaaggccgagtgtctccttgcccaagtttacctatgaccggagggaacacaaga |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
10957620 |
gtgatatgaacaaaactcgttaaagattgtgaagcaatatagaggtgaaggccgagtgtctccttgcccaagtttacctatgactggagggaacacgaga |
10957521 |
T |
 |
| Q |
106 |
aggtaaatagttcaagcaattgcagcaaatcacaatttacttgctccagcagcgacaaggttgaggca |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10957520 |
aggtaaatagttcaagcaattgcagcaaatcacaatttactcgctccagcagcgacaaggttgaggca |
10957453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University