View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_78 (Length: 307)
Name: NF19927_high_78
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 62 - 301
Target Start/End: Complemental strand, 32587654 - 32587428
Alignment:
| Q |
62 |
gatgggagaacgtgaaaatggtgtgcagtgcagtgcaggtattattgatggtactaaaatttttgaatgttgactgattggaagaagcgtaacaaaatca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32587654 |
gatgggagaacgtgaaaatggtgtgcagtgcag-----gtattattgatggtactaaaaattttgaatgttgactgattggaag---cgtaacaaaatca |
32587563 |
T |
 |
| Q |
162 |
aatcaaaatgccgtataatataattacatacaacatcaacaccagatttcacgcatccgtactataggacaatcttgtttaaggcaggccagcgtggctc |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32587562 |
aatcaaaatgccgtataat-----tacatacaacatcaccaccagatttcacgcatccgtactataggacaatcttgtttaaggcaggccagcgtggctc |
32587468 |
T |
 |
| Q |
262 |
acgggttagtctttattgttttgttcccacttcttctcac |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32587467 |
acgggttagtctttattgttttgttcccactccttttcac |
32587428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University