View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_high_82 (Length: 300)
Name: NF19927_high_82
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_high_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 206 - 283
Target Start/End: Complemental strand, 41278185 - 41278108
Alignment:
| Q |
206 |
gtagtgggccgtttccgcgccttcaggtttcccctcgctacattcaaacgtctacccccttttcttttctatcgttac |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41278185 |
gtagtgggccgtttccgcgccttcaggtttcccctcgctacattcaaacgtctacccccttttcttttctatcgttac |
41278108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 71 - 111
Target Start/End: Complemental strand, 41278319 - 41278279
Alignment:
| Q |
71 |
tcatcaatgtgggcagttaatgcaattccattgtttaggac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41278319 |
tcatcaatgtgggcagttaatgcaattccattgtttaggac |
41278279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 41278505 - 41278441
Alignment:
| Q |
9 |
gattattcttgtgtaaatttcatcttagttgtaatgtaannnnnnnnctttattaaatattctca |
73 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41278505 |
gattcttcttgtgtaaatttcatcttagttgtaatgtaattttttttctttattaaatattctca |
41278441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University