View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_102 (Length: 280)
Name: NF19927_low_102
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_102 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 261
Target Start/End: Original strand, 34868972 - 34869234
Alignment:
| Q |
12 |
tgagatgaagaaggaagatggagaagaggagaaacacggtgctgctagggttcgcgagttgcagagtgttgaccgtttcataatttcacgtgttttcggt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34868972 |
tgagttgaagaaggaagatggagaagaggagagacacggtgctgctagggttcgcgagttgcagagtgttgaccgtttcacaatttcacgtgttttcggt |
34869071 |
T |
 |
| Q |
112 |
agcttatgagagaagcttctcaataaattctaacagttaattatcattttgcctttttagataaaaggta-------------aaacgttgtgatcaagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
34869072 |
agcttatgagagaagcttctcaataaattctaacagttaattatcattttgcctttttagataaaaggtaaaacttttagattaaacgttctgatcaagg |
34869171 |
T |
 |
| Q |
199 |
tttaaattagatgtcttttacattgattttgttcaattttcatcattttttaaaagttgaata |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869172 |
tttaaattagatgtcttttacattgattttgttcaattttcatcattttttaaaagttgaata |
34869234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University