View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_103 (Length: 280)
Name: NF19927_low_103
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 37733179 - 37733444
Alignment:
| Q |
1 |
caccaacaatgcaaaactagccataccaacaacaacaaacaaccttatcttatagtcccttaccaatgctgctcctaacaatggaacagtagcaccaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37733179 |
caccaacaatgcaaaactagccataccaacaacaacaaacaaccttatcttatagtcccttaccaatgctgctcctaacaatggaacagtagcaccaaat |
37733278 |
T |
 |
| Q |
101 |
gaaaatgcaattgctgatgcaatagcagcttgaaaaggatttggtagtagctgcttttccttttcaacaaaagtgctgttgattttgttctctcttttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37733279 |
gaaaatgcaattgctgatgcaatagcagcttgaaaaggatttggtagtagctgcttttcctcttcaacaaaagtgctgttgattttgttctctcttttca |
37733378 |
T |
 |
| Q |
201 |
tttgagctaccattatgtcaaactgagtgtacactgatacaaactctccaattcccatactacatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37733379 |
tttgagctaccattatgtcaaactgagtgtacactgatacaaactctccaattcccatactacatg |
37733444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University