View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_105 (Length: 270)
Name: NF19927_low_105
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_105 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 56 - 270
Target Start/End: Complemental strand, 30349768 - 30349554
Alignment:
| Q |
56 |
caagtgccctcaaaattgtaaccccttgctaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata |
155 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349768 |
caagtgccctcaaaattgtaaccccttactaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata |
30349669 |
T |
 |
| Q |
156 |
tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349668 |
tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg |
30349569 |
T |
 |
| Q |
256 |
aaactaaagctaaac |
270 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30349568 |
aaactaaagctaaac |
30349554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University