View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_low_105 (Length: 270)

Name: NF19927_low_105
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_low_105
NF19927_low_105
[»] chr3 (1 HSPs)
chr3 (56-270)||(30349554-30349768)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 56 - 270
Target Start/End: Complemental strand, 30349768 - 30349554
Alignment:
56 caagtgccctcaaaattgtaaccccttgctaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata 155  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30349768 caagtgccctcaaaattgtaaccccttactaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata 30349669  T
156 tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30349668 tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg 30349569  T
256 aaactaaagctaaac 270  Q
    |||||||||||||||    
30349568 aaactaaagctaaac 30349554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University