View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_107 (Length: 267)
Name: NF19927_low_107
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_107 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 9801067 - 9800816
Alignment:
| Q |
1 |
ttcttccgtatatgtgggttgcagtatgattttcaattgcagtttttcagttatgcacttatgctgcaactgcaaaccttaatattgcgggacaatatgg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9801067 |
ttcttccgtatatgtgggtggcagtatgattttcaattgcagttttgcagttatgcacttatgctgcaactgcaaaccttaatattgcgggacaatatgg |
9800968 |
T |
|
| Q |
101 |
tcgaaattgaatttgtgttgccattgcggagacctcaaattcatttatattgtagtcacagttttggttgtggatcgcaatttaaaaccagacacctctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9800967 |
tcgaaattgaatttgtgttgccattgcggagacctcaaattcatttatattgtagtcacagttttggttgtggatcgcaatttaaaaccagacacctctt |
9800868 |
T |
|
| Q |
201 |
tcggcttattaaacaattgttttttaaaggtcctgtgacttcttaatactat |
252 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
9800867 |
tcggcttattaaacaattgttgtttaaaggtcttgtgagttcttaatactat |
9800816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University