View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_121 (Length: 247)
Name: NF19927_low_121
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_121 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 7 - 167
Target Start/End: Original strand, 43403428 - 43403588
Alignment:
| Q |
7 |
gttctgtatactgacatgtatacactctgaccggaacgtgtcacaccgcctccatgatcatctgttagcttatctgctggtgaaaagcatgtaggaatac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403428 |
gttctgtatactgacatgtatacactctgaccggaacgtgtcacaccgcctccatgatcatcggttagcttatctgctggtgaaaagcatgtaggaatac |
43403527 |
T |
 |
| Q |
107 |
caattgagtcttgcatcgtcgtgatctttgatattgcagagaattatgatcaatatataat |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43403528 |
caattgagtcttgcatcgtcgtgatctttgatattgcagagaattacaatcaatatataat |
43403588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 187 - 245
Target Start/End: Original strand, 43403618 - 43403676
Alignment:
| Q |
187 |
ttgatggagcgactcaggttgcgaaaacagcctaattttttaaaaattaggtaaagata |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403618 |
ttgatggagcgactcaggttgcgaaaacagcctaattttttaaaaattaggtaaagata |
43403676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University