View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_124 (Length: 241)
Name: NF19927_low_124
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_124 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 241
Target Start/End: Complemental strand, 33659215 - 33658989
Alignment:
| Q |
15 |
acccttgtatactacatcaaccacagcttccctaaaagtaaatgagattatacttgccatcctcagactttccaatattacctacaatacaagatcttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33659215 |
acccttgtatactacatcaaccacagcttccctaaaagtaaatgagattatacttgccatcctcagactttccaatattacctacaatacaagatcttga |
33659116 |
T |
|
| Q |
115 |
tgagaaatattttcatgaagttgctttcaatataaaacaatagtagtgtgtgtgtatcatagcataccctatgagtaataggcatatttctagtttgacc |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33659115 |
tgagaaatattttgatgaagttgctttcaacataaaacaatagtagtgtgtgtgtatcatagcataccctatgagtaataggcatatttctagtttgacc |
33659016 |
T |
|
| Q |
215 |
ccaactcaatggcatcttccctccttc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33659015 |
ccaactcaatggcatcttccctccttc |
33658989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 33699950 - 33699865
Alignment:
| Q |
15 |
acccttgtatactacatcaaccacagcttccctaaaagtaaatgagattatacttgccatcctcagactttccaatattacctaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || || |||| |||||| || ||||||||||||||||||| |
|
|
| T |
33699950 |
acccttgtatactacatcaaccacagcttccctaaaagtaaatgatatgatgcttgacatccttaggctttccaatattacctaca |
33699865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University