View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_low_125 (Length: 239)

Name: NF19927_low_125
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_low_125
NF19927_low_125
[»] chr4 (1 HSPs)
chr4 (1-217)||(37926993-37927209)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 37927209 - 37926993
Alignment:
1 tacgagaatttacttgattatttcactttttgcaaatgcactgctcgttactatgaaatttgtaacataaaaactcaacctgaacctaaacagaaagcca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
37927209 tacgagaatttacttgattatttcactttttgcaaatgcactgcccgttactatgaaatttgtaaaataaaaactcaacctgaacctaaacagaaagcca 37927110  T
101 aggaggaaagtgtaaaaagaaacctatgcacgatccgacgaaagactttgtgaaagttacagacaacaaatataaagggaaagataaagaagtagtttaa 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37927109 aggaggaaagtgtaaaaagaaacctatgcacgatccgaagaaagactttgtgaaagttacagacaacaaatataaagggaaagataaagaagtagtttaa 37927010  T
201 tttatgaatttggctca 217  Q
    |||||||||||||||||    
37927009 tttatgaatttggctca 37926993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University