View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_126 (Length: 238)
Name: NF19927_low_126
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_126 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 50387409 - 50387304
Alignment:
| Q |
19 |
ccaactgatatattttcttttcctttctaatacattatctttgtgttgtcttgatgtatatgacttcacattgtcgatcatttaattaagtttgtccaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50387409 |
ccaactgatatattttcttttcctttctaatacattatctttgtgttgtcttgatgtatatgacttcacattgtcgatcatttaattaagtttgtccaga |
50387310 |
T |
|
| Q |
119 |
tattat |
124 |
Q |
| |
|
|||||| |
|
|
| T |
50387309 |
tattat |
50387304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University