View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_130 (Length: 237)
Name: NF19927_low_130
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_130 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 45384456 - 45384662
Alignment:
| Q |
1 |
ttccaacaattaaaaattgttaacgtacttgacaccgtatcaaaatagatcatttataactattagttagatgtataaatactcaatatttttaaaatgt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45384456 |
ttccaacaactaaaaattgttaacgtacttgacaccgtatcaaaatagatcatttataactattagttagatgtataaaaactcaatatttttaaaatgt |
45384555 |
T |
|
| Q |
101 |
ttccatttacattctttatacacttcaaaactatataataaatcagtttttccnnnnnnngaaaagaactatagtaataggtctcatcatttctttttag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45384556 |
ttccatttacattctttatacacttcaaaactatataataaatcagtttttccaaaaaaagaaaagaactatagtaataggtctcataatttctttttag |
45384655 |
T |
|
| Q |
201 |
aaccttc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
45384656 |
aaccttc |
45384662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University