View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_134 (Length: 236)
Name: NF19927_low_134
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 41567873 - 41567671
Alignment:
| Q |
1 |
gtatcatagtaattcgagacgacggaaaatgcggtcagagaagtgggaaagatggggacatgagcagtgaaagtaagattgtttttaggtaaagagggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41567873 |
gtatcatagtaattcgagacgacggaaaatgcggtcagagaagtgggaaagatggggacatgagcagtgaaagtaagattgtttttgggtaaagagggag |
41567774 |
T |
 |
| Q |
101 |
ggaaagtgttcttgacgcagacagacaacaaatcaggactttgtatttatttacttttactaaagtgaggacaaatannnnnnnagcttcaccattttat |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41567773 |
ggaaagtgttcttgacacagacagacaacaaatcaggactttgtatttatttacttttactaaagtgaggacaaatatttttttagcttcaccattttat |
41567674 |
T |
 |
| Q |
201 |
tta |
203 |
Q |
| |
|
||| |
|
|
| T |
41567673 |
tta |
41567671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University