View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_low_137 (Length: 233)

Name: NF19927_low_137
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_low_137
NF19927_low_137
[»] chr1 (2 HSPs)
chr1 (1-77)||(38602365-38602434)
chr1 (159-212)||(38602520-38602581)


Alignment Details
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 38602365 - 38602434
Alignment:
1 ataatcaacatattgacaattttgatatctagaatattttaataccaagtacatgcatgagaaccatatatgtgaag 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||    
38602365 ataatcaacatattgacaattttgatatctagaatattttaataccaagt-------tgagaaccatatatgtgaag 38602434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 38602520 - 38602581
Alignment:
159 ctcttccacccttcatttggaa--------gctctaaaacagcctgatcatatacactcaat 212  Q
    ||||||||||||||||||||||        ||||||||||||||||||||||||||||||||    
38602520 ctcttccacccttcatttggaaatatcatggctctaaaacagcctgatcatatacactcaat 38602581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University