View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_151 (Length: 208)
Name: NF19927_low_151
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_151 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 42236770 - 42236857
Alignment:
| Q |
1 |
tccattacaacaacctcctccaccgccacatgctccggcggtttcaggtaatgcagattaatcatcaatgtgatactgatactgcttc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42236770 |
tccattacaacaacctcctccaccgccacatgctcccgcggtttcaggtaatgcagagtaatcatcaatgtgatactgatactgcttc |
42236857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Original strand, 42237057 - 42237085
Alignment:
| Q |
180 |
tattttattagtaatatttttgttattaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42237057 |
tattttattagtaatatttttgttattaa |
42237085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University