View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19927_low_151 (Length: 208)

Name: NF19927_low_151
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19927_low_151
NF19927_low_151
[»] chr1 (2 HSPs)
chr1 (1-88)||(42236770-42236857)
chr1 (180-208)||(42237057-42237085)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 42236770 - 42236857
Alignment:
1 tccattacaacaacctcctccaccgccacatgctccggcggtttcaggtaatgcagattaatcatcaatgtgatactgatactgcttc 88  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||    
42236770 tccattacaacaacctcctccaccgccacatgctcccgcggtttcaggtaatgcagagtaatcatcaatgtgatactgatactgcttc 42236857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Original strand, 42237057 - 42237085
Alignment:
180 tattttattagtaatatttttgttattaa 208  Q
    |||||||||||||||||||||||||||||    
42237057 tattttattagtaatatttttgttattaa 42237085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University