View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_55 (Length: 373)
Name: NF19927_low_55
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 81 - 343
Target Start/End: Complemental strand, 5243550 - 5243286
Alignment:
| Q |
81 |
actaccaccaaagaaagtcataacaagacattatatggaaaataaacaaacctaagacacaaacattgactaccacatgctagctatttattagaaaaac |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243550 |
actaccaccaaagaaagtcataacaagacattatatggaaaataaacaaacctaagacacaaacattgactaccacatgctagctatttattagaaaaac |
5243451 |
T |
 |
| Q |
181 |
taaannnnnnnnnnnnnnn--tttgatcattggttagctatatatataaccaactaacagcatgacctaaaacaaactagtttttgacacacattaaagt |
278 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243450 |
taaaacacacacaacacacactttgatcattggttagctatatatataaccaactaacagcatgacctaaaacaaactagtttttgacacacattaaagt |
5243351 |
T |
 |
| Q |
279 |
tagctagcacataagaggtgatgatgatggatcacttgttctggctcctaccaccaccaccacca |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243350 |
tagctagcacataagaggtgatgatgatggatcacttgttctggctcctaccaccaccaccacca |
5243286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University